MALDI-TOF Working Protocol
Process of rapid identification of pathogenic bacterial species using MALDI-TOF MS (Matrix-assisted laser desorption/ionization – time of flight mass spectrometry)
The MALDI-TOF system can be used to identify clinically significant pathogens (bacteria, fungi) isolated from vaginal, cervical secretions, blood cultures (of pregnant or infertile patients, hospitalized in the Department of Obstetrics), as well as from hypopharyngeal aspirates, cerebrospinal fluid, blood cultures, etc. (of newborns hospitalized in the Department of Neonatology).
MALDI-TOF MS is a technique used in mass spectrometry that allows the analysis of biomolecules (such as DNA, ribosomal proteins, peptides and sugars) and large organic molecules (such as polymers, dendrimers and other macromolecules), and can be used to analyze the protein composition of a bacterial cell. The identification of bacterial proteins is based on their molecular weight.
MALDI-TOF MS involves a laser that acts on a matrix of small molecules to transform the analyte molecules into the gaseous phase without fragmenting or breaking them down. A mass spectrum is generated and automatically compared to a database of mass spectra by the software, resulting in the identification of the organism.
This technique has been shown to be effective due to its reproducibility, speed and sensitivity, with the advantage of MALDI-TOF MS over other methods of identification being that results are available in minutes to a few hours rather than days.
Equipment and consumables:
- Matrix HCCA (alpha-Cyano-4-hydroxycinnamic acid), ported
- Standard solvent (acetonitrile 50%, water 5% and trifluoroacetic acid 2.5%)
- Wooden chopsticks for transferring biological material or plastic inoculation loops
- Pipette tips 5-10 μL, 2-200 μL, 50–1000 μL and corresponding pipettes
- MALDI target plate
- Tubes Shaker (vortexor)
- Formic acid 70%
Preparation of HCCA matrix solution:
- add 250 μL of standard solvent prepared in advance in a HCCA tube
- dissolve HCCA by shaking/vortexing at room temperature until the solution is clear/transparent
Principle:
- ideally, cultures not older than 24 hours should be used for identification, except for slow-growing germs, in which case older cultures (a few days) can also be
- transfer biological material (e.g. an isolated bacterial colony) from a bacterial culture and apply as a thin film directly to a free position on the MALDI target plate
- using the pipette and the 5-10 μL tips, add 1.0 (± 0.1) μL of the Matrix solution
- leave to dry at room temperature (a homogeneous preparation must be obtained)
- the MALDI-TOF-MS measurement is
Note: Although most bacteria will be easily identified by direct application to the Maldi target plate, some organisms possess the capsule that prevents effective lysis of the bacterial cells and obtaining identification. In these situations (e.g. in the case of fungi) a protein extraction procedure is required to identify them correctly. So when initial attempts at direct identification fail, the material can be superimposed with formic acid before the matrix is added.
References
- UK Standards for Microbiology Investigations Matrix-assisted laser desorption/ionisation – time of flight mass spectrometry (MALDI-TOF MS) test procedure; Issued by the Standards Unit, Microbiology Services, PHE; Bacteriology – Test Procedures | TP 40 | Issue no: 1 | Issue date: 27.11.19
MALDI Biotyper Bruker Standard Operating Procedure
WORKING PROTOCOL CHEMILUMINESCENTA
Chemiluminescence determinations (Anti-HAV IgM , Anti-HCV Ac, Anti-HIV Ac, HBsAg,
Toxo-IGG, Toxo-IGM, Rub-IGG, Rub-IGM, CMV-IGG, CMV-IGM, EPB-IGG,EPB-IGM)
Viral and parasitic infectious pathology occupy an important place in the management
of pregnancy at risk, as well as neonatal infections. In this regard, viral hepatitis, HIV infection,
toxoplasmosis, rubella, CMV and EBV infection are some of the most common infections
diagnosed.
Anti-HAV IgM
a) Purpose of the examination: qualitative determination of IgM antibodies against
hepatitis A virus (anti-HAV IgM) using the chemiluminescent method; the
determination is used as a support for the diagnosis of an acute or recent (usually
less than 6 months) infection with hepatitis A virus
b) Principle and method of procedure used for examinations: the method is based
on two-site immunometry; the light signals emitted by the system are directly
proportional to the amount of anti-HAV IgM in the sample
c) Performance characteristics: linearity: 0.02 – 7.0 S/CO; specificity = 100%,
sensitivity = 100%, CV = 7.5%
d) Sample type:
• serum, heparinized plasma or EDTA plasma
• test as soon as possible after harvesting.
• primary samples can be stored closed in the refrigerator until 7 days after
collection
• serum/plasma samples can be frozen up to 180 days after collection
e) Type of container and additives: red stopper container without additive or green
stopper container with heparin or purple stopper container with EDTA
f) Calibration procedures
• Calibration is performed when changing the lot of reagent and calibrator,
once every 28 days,after major service interventions, in case of failure of
internal quality control
g) Interference
• Haemoglobin > 500 mg/dL
• Triglycerides >3000 mg/dL
• Bilirubin > 60 mg/dL
• Proteinaemia: > 12 g/dL
h) Reference biological ranges: Non-reactive
Translation from Romanian
i) Clinical Laboratory Interpretation:
• Samples with value < 0.8 S/CO (signal to cutoff) are considered non-reactive
• Samples with a value of ≥ 0.8 S/CO but less than 1.20 S/CO are
considered inconclusive and must be repeated; it is recommended that the
repeat be done in duplicate and the result released be based on the results of
the repeat; if the result of the repeat is still inconclusive, it is recommended to
obtain a new specimen and test it
• Samples ≥ 1.20 S/CO are considered reactive
j) Potential sources of variation:
a) Heterophilic antibodies present in serum or plasma may interfere with
immunological tests
b) The determination is not validated for other biological products
c) igM anti-HAV are usually detectable between 3 and 6 months after the onset of the
disease (anti-HAV IgG persists throughout life)
Anti-HCV needle
a) Purpose of examination: qualitative detection of IgG antibodies against hepatitis C
virus (anti-HCV) using the chemiluminescent method;determination may be used in
conjunction with other serological tests and clinical information for diagnostic
purposes in patients with symptoms of hepatitis and in individuals at risk of HCV
infection; the product is not intended for screening or testing of serum pools, other
blood types or plasma from more than one individual
b) Principle and method of the procedure used for examinations: the method is based
on two-site immunometry (sandwich technique); the light signals emitted by the
system are directly proportional to the anti-HCV in the sample
c) Performance characteristics: linearity: 0.0 – 11.0 index value; specificity = 99.90%,
sensitivity = 100%, CV = 6.6%
d) Sample type:
• serum, heparinized plasma or EDTA plasma
• samples are handled as potentially infectious
• the samples are tested as soon as possible after collection (they can be kept
uncentrifuged for up to 24 hours at room temperature)
• primary samples can be kept for up to 7 days in the refrigerator
• serum/plasma samples can be frozen
e) Type of container and additives: red stopper container without additive or green
stopper container with heparin or purple stopper container with EDTA
f) Calibration procedures
• Calibration is performed when changing the lot of reagent and calibrator, once
every 28 days,
after major service interventions, in case of failure of internal quality control
g) Interference
• Haemoglobin > 500 mg/dL
• Triglycerides > 1000 mg/dL
• Bilirubin > 60 mg/dL
• Protein level 3-12 g/dL
h) Reference biological ranges: Index value < 0.8 (Non-reactive)
i) Clinical Laboratory Interpretation:
• Samples with index value less than 0.8 are considered non-reactive
• Samples with index value ≥ 0.8 but less than 1.0 are considered inconclusive;
testing is repeated in duplicate; if 2 of the 3 are with index value less than 0.8,
the sample is considered non-reactive; if 2 of the 3 have index value ≥1.0, the
sample is considered reactive and confirmatory tests are recommended; if 2 of
the 3 are with index value ≥ 0.8 and <1 it is recommended to perform additional
tests
• Samples with index value ≥ 1.0 are considered reactive; testing is repeated in
duplicate; if 2 of the 3 are with index value < 0.8, the sample is considered non-
reactive; if 2 of the 3 have index value ≥1.0, the sample is considered reactive
and confirmatory tests are recommended; if 2 of the 3 are with index value ≥ 0.8
and <1.0, additional tests are recommended
• The results are considered invalid and must be repeated if the controls are
outside the allowed limits
j) Potential sources of variation:
• Heterophilic antibodies present in serum or plasma may interfere with
immunological tests
• The determination is not validated for other biological products
• If the result is used for diagnostic purposes, its interpretation should be made in
conjunction with the clinical examination, the patient’s history or other types of
tests
• A negative result does not exclude the possibility of exposure or infection with
HCV; HCV antibodies may be undetectable at some stages of infection and in
some clinical situations
• Test performance has not been studied in immunocompromised populations and
patients
Anti-HIV needle
a) Purpose of the examination: Qualitative detection of antibodies against human
immunodeficiency virus type 1, including subtype O and/or type 2 (anti-HIV) using the
chemiluminescent method
b) Principle and method of the procedure used for examinations: the method is
based on two-site immunometry (sandwich technique); the light signals emitted by the
system are directly proportional to the anti-HIV in the sample
c) Performance characteristics: linearity: 0.05 – 50 index value; specificity = 99.87%,
sensitivity = 100%, CV = 8.8 – 11.6%
d) Sample type:
• serum, heparinized plasma or EDTA plasma
• samples are handled as potentially infectious
• the samples are tested as soon as possible after collection (primary samples can be
kept uncentrifuged for up to 24 hours at room temperature)
• primary samples can be kept for up to 7 days in the refrigerator
• serum/plasma samples can be frozen
e) Type of container and additives: red stopper container without additive or green
stopper container with heparin or purple stopper container with EDTA
f) Calibration procedures
• Calibration is performed when changing the lot of reagent and calibrator, once every
28 days, after major service interventions, in case of failure of internal quality
control.
g) Interference
• Haemoglobin > 500 mg/dL
• Triglycerides >3000 mg/dL
• Bilirubin > 30 mg/dL
• Protein level 3-12 g/dL
h) Reference biological ranges: Index value < 1.0 (Non-reactive)
i) Clinical Laboratory Interpretation:
• Samples with index value < 1.0 are considered non-reactive
• Samples with index value ≥ 1.0 are initially considered reactive and are rewritten
in duplicates after centrifugation; if one or both duplicates are reactive, the
sample is considered repeatedly reactive and confirmatory tests are
recommended; if confirmatory tests are positive, then the sample is considered
to be positive
• Initially reactive samples where both duplicates are non-reactive (index value
<1.0) are considered negative
• The results are considered invalid and must be repeated if the controls are
outside the allowed limits
j) Potential sources of variation:
• Heterophilic antibodies present in serum or plasma may interfere with
immunological tests
• The determination is not validated for other biological products
• It is not recommended to test blood pools or products derived from such
pools
• Test performance has not been studied in immunocompromised populations
and patients
• The test may not detect anti-HIV antibodies in all infected individuals; a
negative result does not exclude the possibility of exposure or infection with
HIV; anti-HIV antibodies may be undetectable at some stages of infection or
in some clinical situations
AgHBs
a) Purpose of examination: qualitative detection of hepatitis B virus surface antigen
(HBsAg) using the chemiluminescent method; determination may be used in
conjunction with other serological tests and clinical information for the diagnosis of
acute and chronic hepatitis B virus infection; determination may also be used for
screening for hepatitis B virus infection in pregnant women to identify newborns at risk
of infection in the neonatal period
b) Principle and method of the procedure used for examinations: the method is based on
two-site immunometry (sandwich technique); the light signals emitted by the system
are directly proportional to the AgHBs in the sample
c) Performance characteristics: linearity: 0.1 – 1000 index value; initial specificity =
99.51%, specificity after retesting = 99.91%, sensitivity = 100%, CV = 3.6%
d) Sample type:
• serum, heparinized plasma or EDTA plasma
• samples are handled as potentially infectious
• the samples are tested as soon as possible after collection (they can be kept
uncentrifuged for up to 24 hours at room temperature)
• primary samples can be stored closed in the refrigerator until 7 days after
collection
• serum/plasma samples can be stored in the refrigerator for up to 14 days or can
be frozen
e) Type of container and additives: red stopper container without additive or green stopper
container with heparin or purple stopper container with EDTA
f) Calibration procedures
• Calibration is performed when changing the lot of reagent and calibrator, once every
21 days, after major service interventions, in case of failure of internal quality control
g) Interference
• Haemoglobin > 500 mg/dL
• Triglycerides > 1000 mg/dL
• Bilirubin > 40 mg/dL
• Cholesterol > 400 mg/dL
• Protein level 3-12 g/dL
h) Reference biological ranges: Index value < 1.0 (Negative)
i) Clinical Laboratory Interpretation:
• Samples with an index value of less than 1.0 are considered non-reactive (negative)
• Samples with index value ≥ 1.0 but less than or equal to 50 are considered reactive
(positive); the test is repeated in duplicate; if 2 of the 3 results are non-reactive
(negative) the result is negative for HBsAg; if 2 of the 3 results are reactive (positive)
the result is considered to be repeated reactive (positive) for HBsAg and confirmatory
tests are recommended, other markers of HBB infection
• Samples with index value > 50 or signaled by the device as “>Index Range” are
considered reactive (positive) for HBsAg and confirmatory tests are recommended
• The results are considered invalid and must be repeated if the controls are outside
the allowed limits
j) Potential sources of variation:
• Heterophilic antibodies present in serum or plasma may interfere with
immunological tests
• The determination is not validated for other biological products
• If the result is used for diagnostic purposes, its interpretation should be made in
conjunction with the clinical examination, the patient’s history or other types of tests
• A negative result does not exclude the possibility of exposure or infection with HBV; a
negative result in a patient exposed to HBV may be generated by HBsAg levels below
the limit of detection of the HBsAg method or lack of reactivity with antibodies from
the reaction
TOXO IgG
a) Purpose of the examination: ToxoplasmaG (Toxo G) is an IgG antibody that captures
microparticles directly chemiluminometric for the in vitro diagnosis of the quantity and
quality of Toxoplasma gondii IgG antigens in serum or plasma (EDTA heparin). The test
can also be used to screen for Toxoplasma G infection in pregnant women to identify
newborns at risk of infection during the neonatal period.
b) Principle and method of the procedure used for examinations: the method is based on
direct immunometry with two sites (sandwich technique); human monoclonal antibodies
are covalently coupled with paramagnetic particles in the solid phase.
c) Performance characteristics: linearity: 0.5 – 700 index value; initial specificity = 96.5%,
specificity after retesting = 99.91%, sensitivity = 96.5%,
d) Sample type:
• Serum, heparinized plasma or EDTA plasma
• Samples are handled as potentially infectious
• Store samples at 2–8°C for up to 7 days
• Freeze samples, free of red blood cells, at or below -20°C for longer storage
• Samples stored at room temperature for up to 7 days or refrigerated for up to
14 days
e) Type of container and additives: red stopper container without additive or green
stopper container with heparin or purple stopper container with EDTA
f) CALIBRATION PROCEDURES
• Calibration is performed when changing the lot of reagent and calibrator, once every
14 days, after major service interventions, in case of failure of internal quality control
g) Interference:
• Haemoglobin > 500 mg/dL
• Triglycerides > 1000 mg/dL
• Bilirubin > 40 mg/dL
• Protein level 3-12 g/dL
h) Reference biological ranges: Index value < 10.0 (Negative)
i) Clinical Laboratory Interpretation:
• Samples with a calculated value of less than 6.4 IU/mL are considered non-
reactive
• Samples with a calculated value between 6.4 and 9.9 IU/mL are equivocal
• Samples with a calculated value greater than or equal to 10.0 IU/mL are
reactive
• The results are considered invalid and must be repeated if the controls are
outside the allowed limits
•
j) Potential sources of variation:
• Heterophilic, antinuclear (AAN), and antimytochondrial (AMA) antibodies present
in serum or plasma may interfere with immunological tests.
• The determination is not validated for other biological products
• If the result is used for diagnostic purposes, its interpretation should be made in
conjunction with the clinical examination, the patient’s history or other types of
tests
• Pay attention to the interpretation of the results for patients who have been
transfused recently or for several months.
TOXO-IgM
a) Purpose of the examination: ToxoplasmaM (Toxo M) is an IgM antibody that captures
microparticles directly chemiluminometric for the in vitro diagnosis of the quantity and
quality of IgM antigens of Toxoplasma gondii in serum or plasma (EDTA heparin). The
determination can also be used to screen for Toxoplasma M infection in pregnant
women to identify newborns at risk of infection during the neonatal period.
b) Principle and method of the procedure used for examinations: the method is based on
direct immunometry with two sites (sandwich technique); human monoclonal antibodies
are covalently coupled with paramagnetic particles in the solid phase.
c) Performance characteristics: linearity: 0.5 – 700 index value; initial specificity = 99%,
specificity after retesting = 99.91%, sensitivity = 99.2%,
d) Sample type:
• Serum, heparinized plasma or EDTA plasma
• Samples are handled as potentially infectious
• Store samples at 2–8°C for up to 7 days
• Freeze samples, free of red blood cells, at or below -20°C for longer storage
• Samples stored at room temperature for up to 7 days or refrigerated for up to 14
days
e) Type of container and additives: red stopper container without additive or green
stopper container with heparin or purple stopper container with EDTA
f) Calibration procedures:
• Calibration is performed when changing the lot of reagent and calibrator, once
every 14 days, after major service interventions, in case of failure of internal
quality control
g) Interference:
• Haemoglobin > 500 mg/dL
• Triglycerides > 1000 mg/dL
• Bilirubin > 40 mg/dL
• Protein level 3-12 g/dL
h) Reference biological ranges: Index value < 1.0 (Negative)
i) Clinical Laboratory Interpretation:
• Samples with a calculated value less than <0.9 IU/mL are considered non-
reactive
• Samples with a calculated value between 0.9 and 0.99 IU/mL are equivocal
• Samples with a calculated value greater than or equal to 1.0 IU/mL are reactive
• The results are considered invalid and must be repeated if the controls are
outside the allowed limits
j) Potential sources of variation:
• Heterophilic antibodies present in serum or plasma may interfere with
immunological tests
• The determination is not validated for other biological products
• If the result is used for diagnostic purposes, its interpretation should be made in
conjunction with the clinical examination, the patient’s history or other types of
tests
• Pay attention to the interpretation of the results for patients who have been
transfused recently or for several months.
RUB-IgG
a) Purpose of examination: In vitro diagnosis for the quantitative and qualitative detection
of Rubella virus IgG antibodies in serum or plasma (EDTA heparin)
b) Principle and method of the procedure used for examinations: the method is based on
direct immunometry with two sites (sandwich technique); human monoclonal
antibodies are covalently coupled with paramagnetic particles in the solid phase.
c) Performance characteristics: linearity: 0.2 – 500 index value; initial specificity = 98.8%,
specificity after retesting = 99.91%, sensitivity = 99.4%,
d) Sample type:
• Serum, heparinized plasma or EDTA plasma
• Samples are handled as potentially infectious
• Freeze samples, free of red blood cells, at or below -20°C for longer storage
• Samples stored at room temperature for up to 7 days or refrigerated for up to
14 days
e) Type of container and additives: red stopper container without additive or green
stopper container with heparin or purple stopper container with EDTA
f) CALIBRATION PROCEDURES
• Calibration is performed when changing the lot of reagent and calibrator, once
every 14 days, after major service interventions, in case of failure of internal
quality control
g) Interference:
• Haemoglobin > 500 mg/dL
• Triglycerides > 1000 mg/dL
• Bilirubin > 40 mg/dL
• Protein level 3-12 g/dL
h) Reference biological ranges: Index value < 5.0 IU/mL (Negative)
i) Clinical Laboratory Interpretation:
• Samples with a calculated value less than < 5.0 IU/mL are considered non-
reactive
• Samples with a calculated value between 5 and 9.9 IU/mL are equivocal
• Samples with a calculated value greater than or equal to 10.0 IU/mL are
reactive
• The results are considered invalid and must be repeated if the controls are
outside the allowed limits
j) Potential sources of variation:
• The determination is not validated for other biological products
• If the result is used for diagnostic purposes, its interpretation should be made
in conjunction with the clinical examination, the patient’s history or other
types of tests
RUB-IgM
a) Purpose of the examination: In vitro diagnosis for the quantitative and qualitative
detection of IgM antibodies of Rubella virus, in serum or plasma (EDTA heparin)
b) Principle and method of the procedure used for examinations: the method is based on
direct immunometry with two sites (sandwich technique); human monoclonal
antibodies are covalently coupled with paramagnetic particles in the solid phase.
c) Performance characteristics: linearity: 0.2 – 500 index value; initial specificity = 99.1%,
specificity after retesting = 99.91%, sensitivity = 91.0%,
d) Sample type:
• Serum, heparinized plasma or EDTA plasma
• Samples are handled as potentially infectious
• Freeze samples at or below -20°C for longer storage
• Samples stored at room temperature for up to 7 days or refrigerated for up to 14
days
e) Type of container and additives: red stopper container without additive or green
stopper container with heparin or purple stopper container with EDTA
f) CALIBRATION PROCEDURES
• Calibration is performed when changing the lot of reagent and calibrator,
once every 14 days, after major service interventions, in case of failure of
internal quality control
g) Interference:
• Haemoglobin > 500 mg/dL
• Triglycerides > 1000 mg/dL
• Bilirubin > 40 mg/dL
• Protein level 3-12 g/dL
• Hypergamaglobulinaemia >3 mg/mL
h) Reference biological ranges: Index value < 0.80 IU/mL(Negative)
i) Clinical Laboratory Interpretation:
• Samples with a calculated value less than <0.80 IU/mL are considered
non-reactive
• Samples with a calculated value between 0.80 and 0.99 IU/mL are
equivocal
• Samples with a calculated value greater than or equal to 1.0 IU/mL are
reactive
• The results are considered invalid and must be repeated if the controls
are outside the allowed limits
j) Potential sources of variation:
• The determination is not validated for other biological products
• If the result is used for diagnostic purposes, its interpretation should be made in
conjunction with the clinical examination, the patient’s history or other types of
tests
• Specimens taken early during the acute phase of infection may not contain
detectable levels of Rubella IgM antibodies, this does not rule out a primary
infection.
CMV IgG
a) Purpose of the examination: qualitative determination of IgG antibodies for
Cytomegalovirus (CMV) in human serum in order to determine the immune status to
Cytomegalovirus.
b) Principle and method of procedure used for examinations: Chemiluminescence.
c) Performance characteristics:.
• Sensitivity : 100%
• Specificity: 100%
d) Sample type:
• human serum or plasma (heparinised or EDTA).
• in case of lipemic serums, ultracentrifugation is recommended
• The primary samples can be stored closed in the refrigerator until 3 days after
collection, at 2–8°C,
• Serum samples can be stored in the freezer for up to 6 months at –20°C.
g) Interference
• Bilirubin: The presence of direct or indirect bilirubin in concentrations up to 200 mg/L
does not affect the result.
• Hemolysis: the presence of hemoglobin in concentrations up to 539 mg/dL does not
affect the result.
• Lipemia: The presence of triglycerides in concentrations up to 3000 mg/dL does not
affect the result .
h) Clinical Laboratory Interpretation:
• Reagent: A ratio of ≥ 1.1 S/CO indicates that IgG antibodies have been detected in
the patient’s serum.
• Non-reactive: a ratio < 0.9 S/CO indicates that IgG antibodies have not been
detected in the patient’s serum
• Inconclusive: a ratio of 0.9 to 1.1 S/CO, requires retesting.
i) Potential sources of variation:
• Heterophilic antibodies in human serum may interfere with immunological tests.
• An increased level of IgG antibodies can be found in the case of measles, varicella-
zoster virus, Epstein-Barr.
CMV IgM
a) Purpose of examination: qualitative determination of IgM antibodies against
Cytomegalovirus(CMV) for the purpose of diagnosis of acute cytomegalovirus infection.
b) Principle and method of procedure used for examinations: Chemiluminescence .
c) Type of sample:
• serum or plasma (EDTA or heparinized)
• The primary samples can be stored closed in the refrigerator until 3 days after
collection, at 2–8°C,
• Serum samples can be stored in the freezer for up to 6 months at –20°C.
•
d) Interference:
Bilirubin: The presence of bilirubin in concentrations up to 200 mg/L does not affect the
result.
Hemolysis: The presence of hemoglobin in concentrations up to 522 mg/dL does not affect
the result
Lipemia: The presence of triglycerides in concentrations up to 3000 mg/dL does not affect
the result.
e) Reference biological ranges: Non-reactive
f) Clinical Laboratory Interpretation:
• Reagent: A ratio of ≥ 1.1 S/CO indicates that IgM antibodies have been detected in
the patient’s serum. The presence of IgM antibodies indicates that the patient had a
recent exposure to Cytomegalovirus.
• Non-reactive: a ratio < 0.9 S/CO indicates that IgM antibodies have not been
detected in the patient’s serum
• Inconclusive: a ratio of 0.9 to 1.1 S/CO, requires retesting.
g) Potential sources of variation:
• An increased level of antibodies can be found in the case of measles, varicella-zoster
virus, Epstein-Barr.
• Samples containing antinuclear antibodies may give false reactive results
EBV-EBNA IgG
a) Purpose of the examination: Qualitative detection of IgG antibodies to the Epstein-Barr
virus (EBNA) nuclear antigen in human serum or plasma. This test can also be used to help
diagnose EBV-related diseases.
(b) Principle and method of the procedure used for examinations: two-stage solid-state
chemiluminescent enzyme immunoassay.
d) Sample type:
• human serum or plasma (heparinised or EDTA)
• In the case of lipemic serums it is recommended to use an ultracentrifuge.
• Hemolysed samples may indicate maltreatment of a sample prior to receipt by the
laboratory; therefore results should be interpreted with caution.
• The primary samples can be stored closed in the refrigerator until 3 days after
collection, at 2–8°C,
• Serum samples can be stored in the freezer for up to 6 months at –20°C.
g) Interference
• Bilirubin: The presence of conjugated and unconjugated bilirubin in concentrations
up to 200 mg/L has no effect on the results.
• Haemolysis: The presence of haemoglobin in concentrations up to 537 mg/dL has no
effect on the results.
• Lipemia: The presence of triglycerides in concentrations up to 3000 mg/dL has no
effect on the results
h) Reference biological ranges
• Reagent : a ratio of ≥ 1.1 S/CO . The report indicates that EBV-EBNA IgG antibodies
were detected in the patient sample.
The presence of IgG antibodies to EBV-EBNA is an indication of prior exposure to the
virus.
• Non-reactive: a ratio of < 0.9. Indicates that EBV-EBNA IgG antibodies were not
detected in the patient sample.
• Inconclusive: a ratio of 0.9 to 1.1 S/CO, requires retesting. Alternative testing is
recommended, or a second sample taken, within a reasonable period of time , e.g.
one week.
j) Potential sources of variation:
• Samples containing antinuclear antibodies or other anti-cellular antibodies may give
false positive results.
EBV-EBNA IgM
a) Purpose of the examination: for the qualitative detection of IgM antibodies to
EpsteinBarr virus viral capsid antigen in human serum or plasma.
b) Principle and method of the procedure used for examinations: chemiluminescent IgM
capture immunoassay, solid phase.
c) Performance characteristics: total concordance: 91.1%, sensitivity: 89.4%, specificity:
96.4%.
d) Sample type:
• serum or plasma (with EDTA and heparinized) In the case of lipemic serums it is
recommended to use an ultracentrifuge.
• Hemolysed samples may indicate maltreatment of a sample prior to receipt by the
laboratory; therefore results should be interpreted with caution.
• The primary samples can be stored closed in the refrigerator until 3 days after
collection, at 2–8°C,
• Serum samples can be stored in the freezer for up to 6 months at –20°C.
f) Interference:
• Biotin: Specimens containing biotin at a concentration of 1500 ng/ml demonstrate a
change of less than or equal to 10% in the results. Biotin concentrations higher than
this may result in incorrect results for patient samples.
• Bilirubin: The presence of conjugated and unconjugated bilirubin in concentrations
up to 200 mg/L has no effect on the results.
• Haemolysis: The presence of haemoglobin in concentrations up to 269 mg/dl has no
effect on the results.
• Lipemia: The presence of triglycerides in concentrations up to 3000 mg/dL has no
effect on the results.
g) Biological reference ranges:
• Reagent : a ratio of ≥ 1.1 S/CO . The report indicates that IgM EBV-EBNA antibodies
were detected in the patient sample.
• Non-reactive: a ratio of < 0.9. Indicates that IgM EBV-EBNA antibodies were not
detected in the patient sample.
• Inconclusive: a ratio of 0.9 to 1.1 S/CO, requires retesting. Alternative testing is
recommended, or a second sample taken, within a reasonable period of time , e.g.
one week.
h) Potential sources of variation:
• Samples containing antinuclear antibodies or other anti-cellular antibodies may give
false positive results.
Vitek 2C System Work Protocol
The Vitek 2 Compact System can be used both to identify and to test the sensitivity to antibiotics of pathogens of clinical significance (bacteria, fungi) isolated from vaginal, cervical secretions, blood cultures (of pregnant or infertile patients, hospitalized in the Department of Obstetrics), as well as from hypopharyngeal aspirates, cerebrospinal fluid, blood cultures, etc. (of newborns hospitalized in the Department of Neonatology).
The Vitek 2 Compact System uses a fluorogenic methodology for the identification of microorganisms and a turbidimetric method for antibiotic sensitivity testing (AST) using appropriate 64-well cards.
1. Identification process on the Vitek 2 system
Aseptically transfer 3 ml of sterile saline (0.45% – 0.50% NaCl, pH 4.5 – 7.0) into a transparent plastic tube. With a sterile loop or swab, the isolated colonies are suspended in the saline solution tube, from the 24-hour culture on blood-geloza. Homogenise the bacterial suspension until a density equivalent to 0,5 – 0,63 McFarland is obtained for unpretentious bacteria, 1,8-2,2 McFarland for fungi and 2,7-3,3 McFarland for the identification of neisserias, species of the genera Haemophilus and Corynebacterium or anaerobes. The tube with the suspension is placed in the cassette, then the Vitek card is inserted. Transferring the inoculum into the card is done automatically in the filling chamber of the device, after which it is transferred to the reader / incubator room.
Identification cards are read based on changes in bacterial growth and metabolism during incubation; they are read every 15 minutes with an optical reader. The results of the biochemical tests are automatically compared with the information in the database, selecting the bacterial species corresponding to the obtained biochemical profile.
2. The process of establishing antibiotic sensitivity on the Vitek 2C system
Vitek AST cards are used to automatically test the sensitivity to antibiotics with the determination of the minimum inhibitory concentration (mic) for pathogens with clinical significance isolated from vaginal secretions, cervical secretions, hemocultures, from patients hospitalized in the department of Obstetrics or hypopharyngeal aspirates, CSF cultures, hemocultures from
newborns hospitalized in the department of Neonatology of SCJUPBT. The tested germs are: Gram negative bacilli, Staphylococcus species, Enterococcus, Streptococcus agalactiae, Streptococcus pneumoniae, fungi, etc.
Principle: Determination of CMI by the microdilution method. Each AST card contains 64 microcells with antibiotics in different concentrations, as well as the control cell.
Technique: a quantity of 145 µl (for gram-positive bacteria) or 280 µl (for gram-negative bacteria) of the suspension of 0.5-0.63 Mc Farland from the bacterial strain, to be tested, is resuspended in 0.45% saline. Insert the antibiogram card into the tube and insert it into the apparatus (incubator/reader).
The growing conditions are optimized to a microaerophilic atmosphere.
The instrument monitors the growth in each card cell over a defined period of time (up to 18 hours). Throughout the incubation period, CMI values are determined every 15 minutes for each antibiotic in the card.
Once the CMI result is obtained, the valid interpretation standards (breakpoint) specified in the Vitek2 software (CLSI-Clinicaland Laboratory Standards Institute) are applied to provide the clinical categories of sensitive, intermediate and resistant.
For testing the sensitivity of gram-negative bacteria, AST-N204, ASTN-222 and AST N-397
cards are used.
The AST-N204 card contains: ampicillin, amoxicillin/clavulanic acid, ceftazidime, cefotaxime, cefepim, piperacillin/tazobactam, ESBL screening (extended spectrum beta- lactamases) imipenem, meropenem, ertapenem, colistin, phosphomycin, ciprofloxacin, norfloxacin, gentamicin, amikacin.
The AST-N222 card contains: ticarcillin, ticarcillin /clavulanic acid, piperacillin, piperacillin
/clavulanic acid, ceftazidim, cefepim, aztreonam, imipenem, meropenem, amikacin, gentamicin, tobramycin, minocycline, colistin, ciprofloxacin, trimethoprim/sulfamethoxazole.
AST card N-397 contains: amoxicillin, cefotaxime, ceftazidime, ceftazidime/avibactam, piperacillin/tazobactam, colistin, ciprofloxacin, gentamicin, tobramycin, amikacin, imipenem, meropenem, trimethoprim/sulfamethoxazole.
For testing the antibiotic sensitivity of gram-positive bacteria (Staphylococcus aureus, coagulase-negative staphylococci, Enterococcus spp and Streptococcus agalactiae, the AST-GP67 card is used (card content in the table):
Antimicrobial | Code | Concentration § | Calling Range | FDA Indications for Use | |
Ampicillin Enterococcusspp. S. agalactiae | AM | 0.5, 4, 8, 32 | 2 0.2 5 | – 3 2 16 | Enterococcusspp., S. agalactiae |
Benzylpenicillin Enterococcusspp. Staphylococcusspp. S. agalactiae | P | 0.125, 0.25, 1, 2, 8, 64 | 0- 12 % 0.0 3 0.1 2 | ≥ 6 4 0.5 64 | Staphylococcusspp., Enterococcus pp., S. agalactiae |
Cefoxitin Screen | OXSF | 6 | NEG | POS | Staphylococcusspp. |
Ciprofloxacin | CIP | 1, 2, 4 | 0.5 | 8 | Staphylococcusspp., Enterococcusspp. |
Clindamycin | CM | 0.5, 1, 2 | 0.25 | 8 | Staphylococcusspp., S. agalactiae |
Erythromycin | E | 0.25, 0.5, 2 | 0.2 5 | 8 | Staphylococcusspp., Enterococcus pp., S. agalactiae |
Gentamycinum | GM | 8, 16, 64 | 0.5 | 16 | Staphylococcusspp. |
Gentamicin High Level (synergy) | HLG | 500 | S | R | Enterococcusspp. |
Inducible Clindamycin Resistance | ICR | CM 0.5, CM/E 0.25/0.5 | NEG | POS | Staphylococcusspp. |
Levofloxacin | LEV | 0.25, 2, 8 | 0.12 | 8 | Staphylococcusspp., Enterococcus pp., S. agalactiae |
Linezolid | LNZ | 0.5, 1, 2 | 0.5 | 8 | S. agalactiae, E. faecalis, E. faecium, S. aureus, S. epidermidis, S. haemolyticus |
Moxifloxacin | MXF | 0.25, 2, 8 | 0.25 | 8 | MSSA** |
Nitrofurantoin | FT | 16, 32, 64 | 16 | 512 | Staphylococcusspp., Enterococcusspp. |
Oxacillin | OX1 | 0.5, 1, 2 | 0.25 | 4 | Staphylococcusspp. |
Quinupristin/ Dalfopristin | QD A | 0.25, 0.5, 2 | 0.25 | 16 | MSSA**, S. epidermidis, VREF**, S. agalactiae |
Rifampicin | RA | 0.25, 0.5, 2 | 0.5 | 32 | Staphylococcusspp. |
Streptomycin High Level (synergy) | HLS | 1000 | S | R | Enterococcusspp. |
: | TE | 0.5, 1, 2 | 1 | 16 | Staphylococcusspp., Enterococcus pp., S. agalactiae |
TigecyclineNS | TGC | 0.25, 0.5, 1 | 0.12 | 2 | E. faecalis, E. faecium, S. aureus, S. epidermidis, S. haemolyticus, S. agalactiae, E. casseliflavus |
Trimethoprim /Sulfamethoxazolce | SXT | 2/38, 8/152, 16/304 | 10(0.5/ 9.5) | 320(16/ 304) | S. aureus |
Vancomycin | VA | 1, 2, 4, 8, 16 | 0.5 | 32 | Enterococcusspp., Staphylococcusspp., S. agalactiae |
For the anthribiogram of various streptococcal species, the AST-ST03 card is used (table below):
Antimicrobial | Code | Concentration § | Calling Range | FDA Indications for Use | |
AmpicillinNS2 | AM | 0.5, 1, 4, 8 | 0.25 | 16 | grpBetaHS**, grpVIR** |
BenzylpenicillinNS2 | P | 0.06, 0.12, 0.5, 2 | 0.06 | 8 | grpC/G**, S. pyogenes, S. agalactiae, S. pneumoniae, grpVIR** |
Cefotaxime | CTX | 0.25, 0.5, 1, 2 | 0.12 | 8 | S. pneumoniae, SpyA**, Streptococcussp p. |
CeftriaxoneNS2 | CRO | 0.12, 0.25, 1.4 | 0.12 | 8 | grpVIR**, S. agalactiae, S. pneumoniae, S. pyogenes |
Chloramphenicol | C | 1, 4, 8 | 1 | 16 | N/A** |
Clindamycinc | CM | CM 0.12, CM 0.25, CM 0.5, CM/E 0.5/0.1 | 0.25 | 1 | SP(Pen(S))**, S. pyogenes, S. agalactiae, S. mitis, S. oralis |
Erythromycin | E | 1, 2, 4, 16 | 0.12 | 8 | S. pneumoniae, S. pyogenes, grpVIR** |
Gentamycinum | GM | 512, 1024 | 64 | 512 | N/A** |
Inducible Clindamycin Resistance S. agalactiae, S. pyogenes | ICR | CM 0.5, CM/E 0.25/0.5 | – NE G | – PO S | S. agalactiae, S. pyogenes |
Levofloxacin | LEV | 1, 2, 4, 16 | 0.25 | 16 | SP+MDRSP* S *, .pyogenes, grpC/F**, grpG**, S. agalactiae, grpVIR**, S. milleri |
LinezolidNS | LNZ | 2, 4 | 2 | 8 | SP+MDRSP** S,. agalactiae, S. pyogenes |
Moxifloxacin | MXF | 0.5, 1, 4, 8 | 0.06 | 4 | S. anginosus, S. constellatus, SP+MDRSP** S,. pyogenes, S. agalactiae, grpVIR** |
Rifampicin | RA | 0.015, 0.03, 0.12, 0.5 | 0.06 | 4 | N/A** |
Teicoplanin | TEC | 0.5, 1, 4 | 0.12 | 4 | N/A** |
Tetracycline | TE | 0.12, 0.5, 1.4 | 0.25 | 16 | S. pneumoniae, S. pyogenes, grpVIR** |
TigecyclineNS | TGC | 0.12, 0.25, 0.5 | 0.06 | 1 | SP(Pen(S))**, S. anginosus grp. (includesS. anginosus , S.intermedius, andS.constellatus), S. agalactiae, S. pyogenes |
Trimethoprim/Sulfam ethoxazolce | SXT | 8/152, 16/304, 64/1216 | 10(0.5/9 .5) | 320(16/3 04) | S. pneumoniae |
VancomycinNS | VA | 0.5, 1, 2, 4 | 0.12 | 8 | grpVIR**, S. pyogenes, S. agalactiae |
For antifungigram, the AST-YS08 card is used, table below:
Antimicrobial | Code | Concentration § | Calling Range | FDA Indications for Use | |
Amphotericin B | AB | 1, 4, 16, 32 | 0.25 | 16 | |
Caspofungin | CAS | 0.12, 0.5, 2, 8 | 0.125 | 8 | N/A** |
Fluconazole, | FLU | 2, 4, 8, 16, 32, 64 | 0.5 | 64 | C. dubliniensis, C. albicans, C. parapsilosis, C. tropicalis, C. guilliermondi, i.c. lusitaniae |
Flucytosine, | FCT | 1, 4, 16, 32 | 1 | 64 | C. albicans, C. dubliniensis, C. glabrata, C. guilliermondi, i.c. lusitaniae, C. parapsilosis, C. tropicalis, |
Micafungin | MCF | 0.06, 0.25, 1.4 | 0.06 | 8 | N/A** |
VoriconazoleSDD | VRC | 0.5, 1, 4, 8 | 0.1 2 | 8 | C. albicans, C. krusei, C. parapsilosis, C. tropicalis, C. lusitaniae, C. guilliermondii |
The reference strains (ATCC American Type Culture Collection) recommended by the card maker will be used as test control witnesses: Escherichia coli ATCC 25922, Escherichia coli ATCC 35218, Pseudomonas aeruginosa ATCC 27853, Klebsiella pneumoniae ssp pneumoniae ATCC 700603, Enterococcus faecalis ATCC 29212, Enterococcus faecalis ATCC 51299, Staphylococcus aureus ATCC 29213, Staphylococcus aureus ATCC BAA-1026, Staphylococcus aureus ATCC BAA-976, Staphylococcus aureus ATCC BAA-977.
To identify fungi
Bibliography: Vitek 2. User Manuals.Biomerieux tool. France, 2009
PGS, preimplantaon genec screening, refers to removing one or more cells from an in vitro ferlized embryo to test for chromosomal normalcy.
An abnormal number of chromosomes is a major cause of in vitro ferlizaon (IVF) failure as most embryos with aneuploidy will not implant or will miscarry during the first trimester of pregnancy. PGS is performed for selecng those embryos with a normal number of chromosomes, increases the chance that a viable embryo will be selected for transfer and the likelihood of successful implantaon and pregnancy.
Our lab has the possibility to use next-generaon sequencing (NGS) technology to provide comprehensive, accurate screening of all 24 chromosomes for selecng euploid embryos. Illumina plaorm that we use enables massively parallel sequencing of millions of DNA fragments, detecng single bases as they are incorporated into growing DNA strands.
General workflow
![]()
DNA extracon and amplificaon
DNA sample -provided by IVF clinics must be suspended in molecular grade 1x PBS (Phosphate Buffered Saline) and, if used, with a maximum concentraon of 0.5% PVP (Polyvinylpyrrolidone) in a volume of 2.5 μl. Samples must be stored at -65 – 85°C following biopsy to preserve integrity and quality. Cell lysis and amplificaon must be completed within 14 days from the harvesng.
Materials required for sample preparation: SurePlex DNA amplificaon system, 20x PBS (dilute to 1x with nuclease-free water), genomic control DNA, PCR tubes (0.2 ml) or 96-well PCR plate and adhesive plate seals, microcentrifuge tube (1.5 ml), genomic DNA 100ng/ µl. Sample and control required
Sample provided by IVF clinics – single cell in 2.5 μl PBS |
Posive control 1: 15 pg genomic DNA in 2.5 µl 1x PBS |
Posive control 2: 60 pg genomic DNA in 2.5 µl 1x PBS |
Negave control: 2.5 µl of 1x PBS |
Negave control: 2.5 µl of collecon buffer control |
Control Tubes for Sample Preparaon
No. | Descripon | Volume PBS 1X | Volume of Female Genomic DNA /Stock Soluon |
1 | 1x PBS negave | 100 µl | None |
2 | 2.5 ng/µl posive | 195 µl | 5 µl of 100 ng/µl stock |
3 | 25 pg/µl posive | 495 µl | 5 µl of 2.5 ng/µl stock (from tube 2) |
4 | 6.25 pg/µl posive | 15 µl | 5 µl of 25 pg/µl stock (from tube 3) |
PCR Tubes for Sample Preparaon
PCR tube no. | Label on Tube Cap | Contents |
1 | 15.6 pos | 2.5 µl of control tube 4 (6.25 pg/µl posive) |
2 | 62.5 pos | 2.5 µl of control tube 3 (25 pg/µl posive) |
3 | Neg | 2.5 µl of control tube 1 (1x PBS) |
Store the control PCR tubes in a 96-well rack on ice unl required. Cell Lysis/Extracon steps
1.Collect samples in 2.5 µl of 1x PBS and 2.5 µl of collecon buffer control. Centrifuge the tubes/plate at 200 × g for 3 minutes at 4°C
2.Add 2.5 µl of Cell Extracon Buffer to each sample (including controls) and store at 2°C to 8°C.
- For every sample or control, add 5 µl of the freshly prepared Extracon Cocktail (4.8 µl Extracon
Enzyme Diluon Buffer + 0.2 µl Cell Extracon Enzyme/ sample)
- Briefly centrifuge samples to get all contents to the botom of the tube and incubate samples in a PCR thermal cycler for the following program:
Number of Cycles | Temperature of Cycle | Incubaon Time |
1 | 75°C | 10 min |
1 | 95°C | 4 min |
1 | 22°C | Hold |
Preamplificaon
For each 10 µl sample prepared in Cell Lysis/Extracon, add 5 µl of SurePlex Pre-amp Cocktail (4.8 µl SurePlex Pre-amp Buffer + 0.2 µl SurePlex Pre-amp Enzyme). Briefly centrifuge and incubate samples according to the following thermal cycler program:
Number of Cycles | Temperature of Cycle | Incubaon Time |
1 | 95°C | 2 min |
12 | 95°C 15°C 25°C 35°C 65°C 75°C | 15 sec 50 sec 40 sec 30 sec 40 sec 40 sec |
1 | 4°C | Hold |
Following preamplificaon the products are maintained on ice Amplificaon steps
- Combine the Amplificaon Cocktail components
Amplificaon Cocktail | Volume per Single Sample |
SurePlex Amplificaon Buffer | 25 µl |
SurePlex Amplificaon Enzyme | 0.8 µl |
Nuclease-free water | 34.2 µl |
Total Volume | 60 µl |
2.Add 60 μl of the freshly prepared Amplificaon Cocktail to the 15 μl pre-amplificaon reacon product, cap the tube, and invert to mix. Centrifuge briefly.
- Amplify samples according to the thermal cycler program.
Number of Cycles | Temperature of Cycle | Incubaon Time |
1 | 95°C | 2 min |
14 | 95°C 65°C 75°C | 15 sec 1 min 1 min |
1 | 4°C | Hold |
4 Keep amplified SurePlex products on ice before proceeding with the VeriSeq PGS assay protocol.
VeriSeq PGS Library Prep
The VeriSeq PGS Library Prep Kit protocol is opmized for 1 ng of input SurePlex amplified DNA. Illumina® strongly recommends quanfying the starng SurePlex amplified dsDNA. Steps for quanficaon are included in this protocol. DNA Input Quantification
To obtain an accurate quanficaon of the DNA library, quanfy the starng DNA library using a fluorometric based method specific for duplex DNA.
Consumables and Equipment
96-well PCR plate, molecular grade water, Qubit dsDNA HS Assay Kit, Qubit Assay Tubes (1 tube per sample) Qubit 2.0 or greater Fluorometer, Adhesive PCR seal,
Procedure
Prepare 1/10 Diluons of SurePlex Sample and Controls 1 Vortex each sample and control.
- Centrifuge at 280 × g for 1 minute.
- In a new PCR plate, add 45 μl molecular-grade water to the required wells.
- Add 5 μl sample or control to the wells containing molecular-grade water.
- Seal the plate and briefly vortex to mix.
- Centrifuge at 280 × g for 1 minute.
- Set aside on wet ice.
Qubit Method
- Prepare the working soluon according to the manufacturer instrucons.
- To calibrate the Qubit fluorometer, add 10 μl of each standard to 190 μl of working soluon.
- Add 10 μl of the 1/10 diluted SurePlex sample and 190 μl working soluon to each assay tube. Briefly vortex to mix.
- For opmal fluorescence, incubate the assay tubes for 2 minutes.
- Calculate the concentraon of each 1/10 diluted SurePlex sample as described by the Qubit dsDNA HS Assay Kit user guide. Convert the units to ng/μl.
Tagment Input DNA
In this step, the SurePlex amplificaon product is tagmented (tagged and fragmented) by the VeriSeq PGS transposome.
Consumables ATM (Amplicon Tagment Mix), TD (Tagment DNA Buffer), NT (Neutralize Tagment Buffer), SurePlex amplificaon product (diluted at 0.2 ng/µl), 96-well PCR plate, Adhesive PCR seal, PCR 8-tube strips
Tagmentation of SurePlex WGA Product
- Label a new PCR plate VTA (VeriSeq Tagment Amplicon Plate).
- Calculate the total volume of TD for all reacons. Using a mulchannel pipete, divide the volume equally among the wells of a PCR 8-tube strip, or use a reservoir.
- Add 10 µl TD Buffer to each well. 4 Add 5 µl ATM to the wells containing TD Buffer.
- Add 5 µl SurePlex amplificaon product (diluted at 0.2 ng/µl) to each sample well.
- Mix at 1,800 rpm for 1 minute centrifuge at 280 × g for 1 minute.
- Make sure that each well contains a volume of 20 µl. Record any nonuniform volumes.
8 Immediately place on a thermal cycler with a heated lid and run the following program: 55°C for 5 minutes/ Hold at 10°C
Neutralization of the Tagmented SurePlex DNA
- Calculate the total volume of NT buffer required for all reacons. Using a mulchannel pipete, divide the volume equally among the wells of a PCR 8-tube strip.
- Add 5 µl NT Buffer to each well. 3 Mix at 1800 rpm for 1 minute.
- Centrifuge at 280 × g for 1 minute.
- Make sure that each well contains a volume of 25 µl. Record any nonuniform volumes.
- Incubate at room temperature for 5 minutes.
Amplify Tagmented DNA
Consumables and Equipment NPM (Nextera® PCR Master Mix), index 1 primers (N701 to N712), index 2 primers (S503 and S504), TruSeq® Index Plate Fixture, Adhesive PCR seal, Plate sealer
Procedure
- Print the sample assay plate layout using the BlueFuse Workflow Manager.
- Arrange the index primers in the TruSeq Index Plate Fixture, as follows:
-Index 1 (i7) adapters: N701–N712 in columns 1–12 -Index 2 (i5) adapters: S503 in row A, S504 in row C
- Place the plate on the TruSeq Index Plate Fixture.
- Add index adapters according to the sample assay plate layout.
-Add 5 μl of each Index 1 (i7) adapter to each column.
-Add 5 μl of each Index 2 (i5) adapter to each row.
- Add 15 μl NPM to each well.
- Mix at 1800 rpm for 1 minute.
- Centrifuge at 280 × g for 1 minute.
- Make sure that each well contains a volume of 50 µl. Record any nonuniform volumes.
- Place on the thermal cycler and run the following program on a thermal cycler with a heated lid:
Number of Cycles | Temperature of Cycle | Incubaon Time |
1 | 72°C | 3 min |
12 | 95°C 55°C 72°C | 10 sec 30 sec 30 sec |
1 | 72°C | 5 min |
1 | 4°C | Hold |
Clean Up PCR -steps
Step that removes both the short library fragments and Primers from the populaon.
- Centrifuge the VTA plate at 280 × g for 1 minute to collect condensaon.
- Add an appropriate volume of beads to a trough.
- Add 45 µl AMPure XP beads to each required well of a clean deep well plate.
- Transfer 45 µl PCR product from the VTA plate to the plate containing beads.
- Mix at 1800 rpm for 1 minute.
- Incubate at room temperature for 5 minutes. Do not shake the plate.
- Pulse centrifuge. To prevent magnec bead aggregaon, do not centrifuge longer than a pulse. 8 Place on a magnec stand and wait unl the liquid is clear (~2 minutes). Keep the plate on the stand during the following steps.
- Discard the supernatant from each well.
- Wash 2 mes, as follows. Using a mulchannel pipete, add 200 µl freshly prepared 80% EtOH to each row on the opposite side of the aggregated beads, being careful not to disturb the bead pellet at the botom of the well. Do not resuspend the beads. Incubate on the magnec stand for ≤ 30 seconds. Start the mer aer dispensing 80% EtOH into the first well being careful to not exceed 30 seconds for each row. Immediately remove and discard all supernatant from each well and discard to appropriate waste
- Using a mulchannel pipete and fine pipete ps, remove residual EtOH from each well.
- Air-dry on the magnec stand for 15 minutes, or unl beads are completely dry.
- Add 50 µl RSB to each well.
- Remove the plate from the magnec stand.
- Mix at 1800 rpm for 1 minute.
- Centrifuge at 280 × g for 1 minute.
- Place on a magnec stand and wait unl the liquid is clear (~2 minutes).
- Transfer 45 µl of each supernatant from each well to a new PCR plate.
- Run a Quality Control check to determine the success of the library preparaon.
Normalize Libraries – steps
1 In a new 15 ml conical tube, prepare the LNA1/LNB1 mix according to the number of reacons. 2 Vortex thoroughly unl LNA1/LNB1 mix is homogenized.
- Label a new deep-well plate LNP (Library Normalizaon Plate).
- Pour the LNA1/LNB1 mix into a reservoir.
- Transfer 45 µl LNA1/LNB1 mix to each well.
- Add 20 µl dsDNA from the Clean-Up PCR procedure to each well.
- Mix at 1800 rpm for 30 minutes.
- Pulse centrifuge to collect any droplets. To prevent magnec bead aggregaon, do not centrifuge longer than a pulse.
- Place on a magnec stand and wait unl the liquid is clear (~2 minutes). Keep the plate on the stand during the following steps.
- Remove and discard all supernatant from each well.
- Discard the ps in an appropriate hazardous waste container.
- Wash beads 2 mes as follows. Keep on the magnec stand and add 45 µl LNW1 to each well. Seal and shake at 1800 rpm for 5 minutes. To prevent magnec bead aggregaon, pulse centrifuge to collect any droplets. Place on a magnec stand and wait unl the liquid is clear (~2 minutes). Remove and discard all supernatant from each well.
- Add 30 µl 0.1 N NaOH to each well.
- Remove from the magnec stand.
- Mix at 1800 rpm for 5 minutes.
- Centrifuge at 280 × g for 1 minute.
- Place on a magnec stand and wait unl the liquid is clear (~2 minutes).
- Add 25 µl of LNS1 to each well of a new PCR plate.
- Transfer 25 µl of supernatant from the LNP plate to the new PCR plate containing LNS1.
- Vortex, and then centrifuge the PCR plate containing LNS1 and supernatant at 280 × g for 1 minute.
Pool Libraries for the MiSeq System
Equal volumes of normalized libraries are combined, diluted in HT1, and heat-denatured before being transferred to the flow cell for cluster generaon and sequencing.
- Centrifuge the plate at 280 × g for 1 minute.
- Transfer 5 µl of each normalized library to pool into a LoBind tube.
- Vortex and centrifuge the pooled library.
- Transfer 15 μl library pool to a new PCR tube or PCR 8-tube strip. The recommended cluster density of the MiSeq VeriSeq PGS workflow ranges from 1,100 K/mm2 to 1,600 K/mm2. Adjust the volume of the library pool to keep the cluster density in the recommended cluster density range.
- Add 85 µl HT1 record the volumes of library pool and HT1.
- Gently vortex and centrifuge the pool/HT1 mixture.
- Immediately place on the preprogrammed thermal cycler and run the DENATURE program.
- Transfer 600 μl of HT1 into a second clean LoBind tube. Set aside in an ice-water bath.
- When the denaturaon is complete, immediately transfer 100 µl of denatured pool/HT1 mixture to the LoBind tube with HT1. Set aside on wet ice.
- Sequence your library
MiSeq Sequencing VeriSeq PGS workflow
Thaw Reagent Cartridge Inspect the Reagent Cartridge 1 Remove the reagent cartridge from -25°C to -15°C storage.
- Place the reagent cartridge in a water bath containing enough room temperature deionized water to submerge the base of the reagent cartridge. Do not allow the water to exceed the maximum water line printed on the reagent cartridge.
- Allow the reagent cartridge to thaw in the room temperature water bath unl it is thawed completely. 4 Remove the cartridge from the water bath and gently tap it on the bench to dislodge water from the base of the cartridge. Dry the base of the cartridge.
5.Inspect the reagents in posions 1, 2, and 4 to make sure that they are fully mixed and free of precipitates.
6 Place the reagent cartridge on ice for up to six hours, or set aside at 2°C to 8°C unl ready to set up the run. For best results, proceed directly to loading the sample and seng up the run.
Load Sample Libraries
- Clean the foil seal covering the reservoir labeled Load Samples with a low-lint lab ssue.
- Pierce the foil seal with a clean 1 ml pipete.
- Pipete 600 µl prepared libraries into the reservoir Load Samples. Avoid touching the foil seal
- Proceed directly to the run setup steps using the MiSeq Control Soware (MCS) interface.
Clean/ Load the Flow Cell
- Using plasc forceps, grip the flow cell by the base of the plasc cartridge and remove it from the flow cell container
- Lightly rinse the flow cell with laboratory-grade water unl both the glass and plasc cartridge are thoroughly rinsed of excess salts.
- Using care around the black flow cell port gasket, thoroughly dry the flow cell and cartridge with a linree lens cleaning ssue. Gently pat dry in the area of the gasket and adjacent glass.
- Clean the flow cell glass with an alcohol wipe. Make sure that the glass is free of streaks, fingerprints, and lint or ssue fibers.
- Dry excess alcohol with a lint-free lens cleaning ssue.
- Make sure that the flow cell ports are free of obstrucons and that the gasket is well-seated around the flow cell ports
7.Raise the flow cell compartment door, and then press the release buton to the right of the flow cell clamp.
8.Make sure that the flow cell stage is free of lint. If lint or other debris is present, clean the flow cell stage using an alcohol wipe or a lint-free ssue moistened with ethanol or isopropanol. Carefully wipe the surface of the flow cell stage unl it is clean and dry.
9.Holding the flow cell by the edges, place it on the flow cell stage, gently press down on the flow cell clamp to close it over the flow cell. Close the flow cell compartment door.
Load Reagents and Start the Run
- Remove the botle of PR2 from 2° to 8°C storage. Invert to mix, and then remove the lid.
- Open the reagent compartment door.
- Raise the sipper handle unl it locks into place.
- Remove the wash botle and load the PR2 botle.
- Empty the contents of the waste botle into the appropriate waste container.
- Slowly lower the sipper handle. Make sure that the sippers lower into the PR2 and waste botles.
- Open the reagent chiller door.
- Hold the reagent cartridge on the end with the Illumina label, and slide the reagent cartridge into the reagent chiller unl the cartridge stops.
- Close the reagent chiller door.
- Aer loading the flow cell and reagents, review the run parameters and perform a pre-run check before starng the run. When all items successfully pass the pre-run check, select Start Run. During a run, monitor run detail using the Sequencing screen on the instrument.
Data Analysis
Aneuploidy screening embryos prior to transfer has been shown to deliver significant improvements IVF success. Preimplantaon genec diagnosis (PGD) enables screening of embryos for specific genec condions prior to transfer. Following sequencing sample informaon is uploaded directly from the MiSeq System, saving me and allowing sample tracking. BlueFuse Mul is a sophiscated soware for analyzing and interpreng results from molecular cytogenomic studies.

Sample informaon includes sample type (e.g., blood, CVS, amnioc fluid), date of birth, pedigree number, and phenotype. Related samples can be overlaid for data comparisons and regions of change compared to phenotype. Data are permanently available and can be revisited and interrogated at any me ensuring that any follow-up quesons can be readily answered. NGS provides reliable, comprehensive screening of 24-chromosome aneuploidy, achieving results with a high degree of concordance to those obtained using established array-based PGS techniques. NGS offers a readily available, high-throughput method for PGS in the clinic with the potenal benefits of reduced costs and enhanced precision.
Karyomapping is a molecular karyotyping method that can be used on a single cell or few cells from embryo biopsy samples. The method provides a comprehensive test for preimplantation genetic diagnosis (PGD) of single gene defects. It can be used where there is a risk of severe genetic disorders being inherited from parents. A couple could have a family history of a genetic disorder or have had a child with a genetic disease. PGD screening with karyomapping can be used to identify embryos that do not carry defective genes and can be safely transferred.
The assay requires single or multi-cell embryo biopsy samples amplified by Multiple Displacement Amplification (MDA) as starting material. The use of an MDA-based whole genome amplification (WGA) method is essential to amplify DNA from embryo biopsy samples (blastomere and trophectoderm biopsied cells) to quantities suitable for use in the Infinium Karyomapping Assay.
The first step of the Infinium Karyomapping Assay protocol is the WGA of the DNA generated from MDA amplified embryo biopsies and the genomic DNA from parents and reference. The preparation for this amplification is included in Prepare and Incubate the MSA3 Plate, this step should be performed in a pre-amp area specific for the WGA of the Infinium Karyomapping Assay.
The remaining Infinium Karyomapping Assay protocol steps can be performed in a postamplification (post-amp) area that is a separate laboratory space from the amplification areas.
Sample Input Requirements
Single and multi-cell biopsy samples do not have the required quantities of genomic DNA to be used as starting material in the Infinium Karyomapping Assay. To overcome this limitation, an initial WGA of the embryo biopsy samples using MDA is essential. In this process, genomic DNA starting from as low as 6.5 pg is amplified >1000-fold resulting in several micrograms of amplified DNA. A suitable MDA kit should be used for amplifying DNA from embryo biopsy samples. End products of MDA should meet the following criteria to be suitable for their use in the Infinium Karyomapping Assay:
-Product length after MDA should be in the range of 2 to 100 kb
– Amplified product mass of 1600 to 6400 ng in a total of 8 μl (200 to 800 ng/μl of the completed MDA reaction).
Prepare and Incubate the MSA3 Plate
Good quality parental and reference genomic DNA is required for karyomapping. The DNA is added to the MSA3 DNA plate at this stage together with the MDA amplified biopsy samples. This step denatures and neutralizes the samples, preparing them for WGA. During incubation, the genomic and amplified DNA is further amplified and prepared for downstream procedures
Consumables
MA1 | 1 tube |
MSM | 1 tube |
MA2 | 1 tube |
0.1N NaOH | 1 tube |
96-well 0.8ml storage plate (MIDI) | 1 plate |
DNA plate with genomic DNA samples (50ng/ μl) | 1 plate or tubes |
DNA plate with MDA amplified products | 1 plate or tubes |
Steps
1 Dispense 40 μl MA1 into the MSA3 plate wells of the midi plate. Fill wells according to the plate layout diagram where columns 1 and 2 contain samples for a single BeadChip.
2 Transfer 8 μl (50 ng/μl) of gDNA from parents and reference, followed by 8 μl of amplified gDNA from the MDA plate, to the corresponding wells of the MSA3 plate.
3 In the Lab Tracking Form, record the original DNA sample ID for each well in the MSA3 plate.
4 Dispense 8 μl 0.1N NaOH into each well of the MSA3 plate that contains MA1 and sample.
5 Seal the MSA3 plate with a 96-well cap mat, vortex the plate at 1600 rpm for 1 minute, pulse centrifuge at 280 × g, incubate for 10 minutes at room temperature
6 Dispense 68 μl MA2 into each well of the MSA3 plate containing sample.
7 Dispense 76 μl MSM into each well of the MSA3 plate containing sample.
8 Reseal the MSA3 plate with the cap mat, vortex the sealed MSA3 plate at 1600 rpm for 1 minute, pulse centrifuge at 280 × g, incubate in the heat block with midi insert for 2 hours at 37°C.
Fragment the DNA
Consumables
FMS | 1 tube |
Steps
1 Pulse centrifuge the MSA3 plate to 280 × g.
2 Add 50 μl FMS to each well containing sample.
3 Seal the MSA3 plate with the 96-well cap mat, vortex the plate at 1600 rpm for 1 minute, pulse centrifuge the plate to 280 × g.
4 Place the sealed plate on the 37°C heat block for 30 minutes.
Precipitate the DNA
Consumables
PM1 | 1 tube |
100% 2 propanol | 15 ml |
Steps
1 Remove the 96-well cap mat and add 100 μl PM1 to each MSA3 plate well containing sample.
2 Seal the plate with the cap mat, vortex the sealed plate at 1600 rpm for 1 minute.
3 Place the sealed plate on the 37°C heat block for 5 minutes, pulse centrifuge at 280 × g
4 Add 310 μl 100% 2-propanol to each well containing sample.
5 Carefully seal the MSA3 plate with a new, dry cap mat, taking care not to shake the plate in any way until the cap mat is fully seated, invert the plate at least 10 times to mix contents thoroughly.
6 Place the sealed MSA3 plate in the centrifuge opposite another plate of equal weight, centrifuge at 1000 × g at 4°C for 20 minutes, remove the MSA3 plate from centrifuge.
7 Over an absorbent pad, decant the supernatant by quickly inverting the MSA3 plate. Drain liquid onto the absorbent pad and then smack the plate down, avoiding the liquid that was drained onto the pad.
8 Tap firmly several times for 1 minute or until all wells are devoid of liquid.
9 Leave the uncovered, inverted plate on the tube rack for 15 minutes at room temperature to air dry the pellet. After drying, make sure that blue pellets are present at the bottoms of the wells.
Resuspend the DNA
Consumables
RA1 | 17 μl /sample |
Steps
1 Add 17 μl RA1 to each well of the MSA3 plate containing a DNA pellet.
2 Apply a foil heat seal (with the dull side facing down) to the MSA3 plate by firmly and evenly holding the heat sealer sealing block down for 5 seconds.
3 Immediately remove the MSA3 plate from the heat sealer and forcefully roll the rubber plate sealer over the plate until you can see all 96 well indentations through the foil. Repeat application of the heat sealer if all 96 wells are not defined.
4 Place the sealed plate in the Illumina Hybridization Oven and incubate for 15 minutes at 48°C.
5 Vortex the plate at 1800 rpm for 1 minute, pulse centrifuge to 280 × g.
Hybridize DNA to the BeadChip
Consumables
PB2 | 1 tube |
Bead Chips | 1 |
Hyb Chambers | 1 |
Hyb Chambers gaskets | 1 |
Hyb Chambers inserts | 1 |
EtOH | 330ml |
Prepare the Hybridization Chambers
1 Place the resuspended MSA3 plate on the heat block to denature the samples at 95°C for 20 minutes. On the Lab Tracking Form, enter the start and stop times.
2 After the 20 minute incubation, remove the MSA3 plate from the heat block and place it on the benchtop at room temperature for 5 minutes to cool.
Load BeadChips
1 After the 5 minute cool down, pulse centrifuge the MSA3 plate to 280 × g.
2 Just before loading DNA samples, remove all BeadChips from their ziplock bags and mylar packages.
3 Place each BeadChip in a Hyb Chamber insert, orienting the barcode end so that it matches the barcode symbol on the Hyb Chamber insert.
4 Remove the foil seal from the MSA3 plate, and then, using a multichannel precision pipette, dispense 15 μl of each DNA sample onto the appropriate BeadChip section.
5 After loading all DNA onto the BeadChip, wait for the sample to disperse over the entire surface.
6 Inspect the loading port to see if a large bolus of liquid remains. Excess sample volume in the BeadChip loading port helps prevent low-intensity areas resulting from evaporation.
Set up the BeadChips for Hybridization
1 Load the Hyb Chamber inserts containing BeadChips into the Illumina Hyb Chamber. Position the barcode end over the ridges indicated on the Hyb Chamber.
2 Place the back side of the lid onto the Hyb Chamber and then slowly bring down the front end to avoid dislodging the Hyb Chamber inserts.
3 Close the clamps on both sides of the Hyb Chamber so that the lid is secure and even on the base (no gaps). It is best to close the clamps in a kitty-corner fashion, closing first the top left clamp, then the bottom right, then the top right followed by the bottom left.
4 Place the Hyb Chamber in the 48°C Illumina Hybridization Oven so that the Illumina logo on top of the Hyb Chamber is facing you.
5 Incubate at 48°C for 12 hours or overnight but no more than 24 hours.
Wash the BeadChip
Consumables
PB1 | 550 ml (up to 4 BeadChips) |
MultiCample BeadChip Alignment Fixture | 1 (per 4 BeadChips) |
Te- Flow flow -through chambers | 1 / BeadChip |
Wash dish | 2 |
Wash rack | 1 |
Steps
1 Attach the wire handle to the rack and submerge the wash rack in the first wash dish containing 200 ml PB1.
2 Remove a BeadChip from the Hyb Chamber and then remove its cover seal.
3 Immediately and carefully slide the BeadChip into the wash rack, making sure that the BeadChip is submerged in the PB1.
4 When all the BeadChips are in the wash rack, move the wash rack up and down for 1 minute, breaking the surface of the PB1 with gentle, slow agitation.
5 Move the wash rack to the other wash dish containing clean PB1. Make sure the BeadChips are submerged.
6 Move the wash rack up and down for 1 minute, breaking the surface of the PB1 with gentle, slow agitation.
8 When you remove the BeadChips from the wash rack, inspect them for remaining residue.
Assemble Flow-Through Chambers
1 Fill the BeadChip Alignment Fixture with 150 ml PB1.
2 For each BeadChip to be processed, place a black frame into the BeadChip Alignment Fixture.
3 Place each BeadChip into a black frame, aligning its barcode with the ridges stamped onto the Alignment Fixture. Make sure that each BeadChip is fully immersed in PB1.
4 Place a clear spacer onto the top of each BeadChip. Use the Alignment Fixture grooves to guide the spacers into proper position.
5 Place the Alignment Bar onto the Alignment Fixture. Make sure that the groove in the Alignment Bar fits over the tab on the Alignment Fixture.
6 Place a clean glass back plate on top of the clear spacer covering each BeadChip. Make sure that the plate reservoir is at the barcode end of the BeadChip, facing inward to create a reservoir against the BeadChip surface.
7 Attach the metal clamps onto each flow-through chamber as follows:
a Gently push up the glass back plate against the Alignment Bar with one finger.
b Place the first metal clamp around the flow-through chamber so that the clamp is 5 mm from the top edge.
c Place the second metal clamp around the flow-through chamber at the barcode end, 5 mm from the bottom of the reagent reservoir
8 Remove the assembled flow-through chamber from the alignment fixture and, using scissors, trim the spacer at the nonbarcode end of the assembly. Slip the scissors up over the barcode to trim the other end.
Extend and Stain (XStain) BeadChips
Consumables
RA1 | 5 ml (per 4 BeadChips) |
XC1 | 1 tube (per 4 BeadChips) |
XC2 | 1 tube (per 4 BeadChips) |
TEM | 1 tube (per 4 BeadChips) |
XC3 | 25 ml (per 4 BeadChips) |
STM | 1 tube (per 4 BeadChips) |
ATM | 1 tube (per 4 BeadChips) |
PB1 | 310 ml (up to 4 BeadChips) |
XC4 | 310 ml (up to 4 BeadChips) |
Alconox Power Detergent | as needed |
EtOH | as needed |
95% formamide / 1mM EDTA | 10 ml (up to 4 BeadChips) |
Single-Base Extension
1 When the Chamber Rack reaches 44°C ± 0.5°C, quickly place each flow-through chamber assembly into the Chamber Rack.
2 Into the reservoir of each flow-through chamber, dispense:
a150 μl RA1. Incubate for 30 seconds. Repeat 5 times.
b 450 μl XC1. Incubate for 10 minutes.
c 450 μl XC2. Incubate for 10 minutes.
d 200 μl TEM. Incubate for 15 minutes.
e 450 μl 95% formamide/1 mM EDTA. Incubate for 1 minute. Repeat one time.
f Incubate 5 minutes.
g Begin ramping the Chamber Rack temperature to the temperature indicated on the STM tube ± 0.5°C.
h 450 μl XC3. Incubate for 1 minute. Repeat one time.
Stain BeadChip
1 Into the reservoir of each flow-through chamber, dispense:
a 250 μl STM. Incubate for 10 minutes.
b 450 μl XC3. Incubate for 1 minute. Repeat one time.
c Wait 5 minutes. d 250 μl ATM. Incubate for 10 minutes.
e 450 μl XC3. Incubate for 1 minute. Repeat one time.
f Wait 5 minutes. g 250 μl STM. Incubate for 10 minutes.
h 450 μl XC3. Incubate for 1 minute. Repeat one time.
i Wait 5 minutes.
j 250 μl ATM. Incubate for 10 minutes.
k 450 μl XC3. Incubate for 1 minute. Repeat one time.
l Wait 5 minutes.
m 250 μl STM. Incubate for 10 minutes.
n 450 μl XC3. Incubate for 1 minute. Repeat one time.
o Wait 5 minute
Wash and Coat BeadChips
Steps
1 Set up 2 top-loading wash dishes, labeled „PB1” and „XC4”, pour 310 ml PB1 into the wash dish labeled “PB1.”, submerge the unloaded staining rack into the wash dish with the locking arms and tab facing towards you.
2 Disassemble each flow-through chamber, use the dismantling tool to remove the 2 metal clamps, remove the glass back plate by lifting the glass straight up, set the glass back plate aside, remove the spacer, remove the BeadChip from the black frame.
3 Place the BeadChips in the staining rack while it is submerged in PB1, slowly move the staining rack up and down 10 times, breaking the surface of the reagent, soak for 5 minutes.
- Shake the XC4 bottle vigorously to ensure complete resuspension. If necessary, vortex until dissolved, pour 310 ml XC4 into the dish labeled “XC4,” and cover the dish to prevent any lint or dust from falling into the solution.
5 Remove the staining rack from the PB1 dish and place it directly into the wash dish containing XC4, slowly move the staining rack up and down 10 times, breaking the surface of the reagent, soak for 5 minutes.
6 Remove the staining rack in one smooth, rapid motion and place it directly on the prepared tube rack, place the tube rack in the vacuum desiccator. Start the vacuum, using at least 675 mm Hg (0.9 bar). Dry under vacuum for 50–55 minutes
- Scan the BeadChips within 72 hours.
Perform analysis using BlueFuse Multi software, which requires that scanning data are available in a genotype call (GTC) file format. By default, the NextSeq 550 system generates normalized data and associated genotype calls in the format of a GTC file. The iScan can be configured to produce GTC files, in addition to the standard file types (such as IDAT files).
When couples have experienced multiple failed IVF transfers or women have had recurrent miscarriages, it’s crucial to consider customized genetic screening and testing to identify potential underlying causes. Customized protocols can help pinpoint specific issues and guide treatment decisions. Here’s a suggested approach:
- Initial Consultation:
Start with a comprehensive consultation with a reproductive specialist or fertility expert who can assess the medical history, previous fertility treatments, and genetic background of both partners.
- Chromosomal Testing:
- Karyotype Analysis: Assess the chromosomal makeup of both partners to identify any structural or numerical chromosomal abnormalities that might contribute to recurrent miscarriages.
- Preimplantation Genetic Testing (PGT-A or PGT-M): If you’re pursuing IVF, consider PGT-A (aneuploidy screening) or PGT-M (monogenic disorder screening) to select embryos with the highest chance of success.
- Hormonal and Autoimmune Testing:
Evaluate hormone levels, thyroid function, and autoimmune markers. Imbalances or autoimmune issues can affect fertility and may lead to recurrent miscarriages.
- Genetic Carrier Screening:
Both partners should undergo genetic carrier screening to identify potential recessive genetic conditions. Carrier status can impact the likelihood of genetic disorders in offspring.
- Thrombophilia and Blood Clotting Disorders:
Investigate for thrombophilia and blood clotting disorders, as these conditions may lead to recurrent miscarriages.
- Immunological Factors:
Explore potential immunological factors affecting fertility and pregnancy, including antiphospholipid syndrome and natural killer cell activity.
- Endometrial Receptivity Testing:
Assess the uterine lining to ensure it is receptive for embryo implantation. Endometrial receptivity testing may include a receptive window assessment.
- Hysteroscopy:
A hysteroscopy can detect uterine abnormalities or polyps that might interfere with implantation or cause recurrent miscarriages.
- Lifestyle and Environmental Factors:
Evaluate lifestyle factors like diet, exercise, and stress, as well as environmental exposures, which may impact fertility and pregnancy outcomes.
- Multidisciplinary Team:
Consider involving a multidisciplinary team of fertility experts, genetic counselors, and specialists to develop a tailored plan for each couple.
- Treatment Options:
Based on the findings, develop a personalized treatment plan, which may include adjusting IVF protocols, lifestyle modifications, medications, or surgical interventions.
- Counseling and Emotional Support:
Recurrent IVF failures and miscarriages can be emotionally challenging. Provide psychological support and counseling to help couples cope with the stress.
- Ongoing Monitoring:
Regularly monitor the progress and adjust as needed, based on the response to treatment.
Customized genetic screening and testing protocols should be adapted to each couple’s unique situation. It’s essential to work closely with a fertility specialist to address specific concerns and tailor the testing and treatment plan accordingly. Genetic counseling can help couples understand their genetic risks and make informed decisions regarding family planning.
We created an advanced next-generation sequencing (NGS) panel designed to examine genes linked to infertility. This panel specifically focused on exons and their surrounding regions, incorporating selected introns within the CFTR gene. Additionally, the analysis of the FMR1 gene and Y chromosome microdeletions was carried out using other recommended techniques.
DNA
- DNA extracted from blood and saliva using the QIAamp Mini Kits (Qiagen) following the manufacturer’s instructions;
- DNA quantification using Qubit dsDNA BR Assay Kit and the Qubit® 3.0 fluorometer;
- genes with proven disease-associated variants related to infertility disorders included in the targeted NGS panel („diagnostic genes”). The panel also included „candidate genes” which their association with infertility needs further study;
- selection of the genes based mainly on relevant literature referenced in PubMed and Online Mendelian Inheritance in Man (OMIM) and guided by ClinGen Clinical Validity Classifications (Strande et al., 2017);
- designated panel should encompass the coding exons and adjacent regions, extending at least 10 nucleotides upstream and downstream of each exon (in accordance with the RefSeq database);
- clinically significant noncoding (intronic) areas harboring known pathogenic variants in the CFTR gene should also be part of the panel;
- specific regions for determining the sample’s gender should be incorporated as an internal control.
Next-generation DNA sequencing
- DNA samples prepared for sequencing following the manufacturer’s instructions described in the SureSelectQXT Target Enrichment for Illumina Multiplexed Sequencing manual (Agilent Technologies, Inc.), a transposase-based library preparation technology;
- DNA libraries quantification performed using Qubit dsDNA Assay with the Qubit® 3.0 fluorometer. DNA Libraries were sequenced on a MiSeq platform (Illumina, San Diego, CA) using a 300 cycles-MiSeq Reagent Micro Kit v2 following the manufacturer’s instructions.
Sequence analysis and variant interpretation
Sequence data analysis was carried out using an in-house developed bioinformatic pipeline, built on the best practices in the field.
- data demultiplexed and converted to Fastq format simultaneously using bcl2fastq software (Illumina, 2017);
- quality control of the data performed using FastQC software (Babraham Bioinformatics, 2017). Reads aligned against the human reference genome hg19 using Burrows-Wheeler Aligner v0.7.17 (Li & Durbin, 2009) and in order to detect single-nucleotide variants (SNVs) and small insertions and deletions, Genome Analysis Toolkit v4.0 was used (Van der Auwera et al., 2013);
- for obtaining biological and functional information, variants annotated against several databases, such as ClinVar, dbSNP, 1000Genomes, dbNSFP and ExAC, among others, using SnpEff software v4.3i (Cingolani et al., 2012).
We employed allele frequency as a criterion for categorizing identified variants into common or rare groups. Variants with an allele frequency of ≥ 5% in ExAC were designated as common and subsequently excluded, with a few exceptions. Among the included genes, some were associated with pharmacogenetic effects, particularly those encoding receptors that could influence the response to ovarian hyperstimulation treatment. For these genes, variants with an allele frequency higher than 5% were also scrutinized. Additionally, the filtering process took into account the outcomes from various bioinformatic predictors regarding pathogenicity and the variant’s type of effect.
Finally, filtered variants were classified as pathogenic, likely pathogenic, variant of unknown significance (VUS), likely benign or benign, according to the American College of Medical Genetics and Genomics (ACMG) and the Association for Molecular Pathology (AMP) guidelines (Richards et al., 2015). The report of the variants was made according to the Human Genome Variation Society (HGVS) nomenclature (den Dunnen et al., 2016).
FMR1 testing FMR1 testing was performed using 20-80 ng of genomic DNA per sample. The FMR1 CGG repeat region was amplified using the AmplideX® PCR/CE FMR1 kit (TP-PCR), following the manufacturer’s instructions. PCR products were then separated by capillary electrophoresis on an ABI 3500xL. Manual annotation was performed using GeneMapper® 5.0 software (Applied BiosystemsTM).
CFTR, T/TG tract analysis. The amplification of intron 9 – exon 10 region was performed using the following conditions: genomic DNA was amplified in a reaction that contained 2µL 50µM of each primer (Invitrogen), 0.4µL 10 mM dNTP Set (Invitrogen), 2,5µL 50 mM MgCl, 0,2µL 5U/µL Taq DNA polymerase (Invitrogen), 5µL 10x buffer and 2µL 20-60 ng/µL genomic DNA. It was completed with sterile distilled water up to a volume of 50µL. The primers used were: 5´CCATGTGCTTTTCAAACTAATTGT3´ (forward), 5´TAAAGTTATTGAA TGCTC GCCATG 3´(reverse).
The diagnosis of Y chromosome microdeletion was made by two multiplexes PCRs. Both reactions amplify three AZF loci and the SRY control fragment. DNA samples from a fertile male and female were used as an internal controls in each multiplex assay according to the recommendations of the European Academy of Andrology (EAA) and the European Molecular Genetics Quality Network (EMQN) guidelines (Krausz et al, 2014).
The 50 µL PCR reaction mix contained: 0.4µL 10 mM dNTP Set (Invitrogen), 1.85µL 50 mM MgCl, 0.4µL 5U/µL Taq DNA polymerase (Invitrogen), 2.5µL 10x buffer, 4µL 100 ng/µL template DNA and sterile distilled water.
Amplification conditions:
- start with an initial step of 94°C 2 min;
- 35 cycles at 94°C for 30 sec, 60°C for 30 sec and 72°C for 30 sec;
- ended by a last elongation step of 7 min at 72ºC using a Veriti 96-well thermal cycler (Applied Biosystems, Foster City, CA);
- reaction products separated by 3% agarose gel electrophoresis.
Fertility gene panel design
After the selection and classification of genes associated with infertility, a custom sequencing panel was designed including 75 genes. Genes were grouped into two sub-panels: a female fertility panel and a male fertility panel (Lorenzi et al., 2020).
Female conditions |
|
Primary ovarian insufficiency | BMP15, ESR1, FGFR1, FIGLA, FMR1, FOXL2, FSHB, FSHR, GALT, GDF9, HFM1, KISS1R, LHB, MCM8, MCM9, NOBOX, NR5A1, POF1B, PSMC3IP, SOHLH1, STAG3, SYCE1, DIAPH2, DMC1, FOXO3, LHCGR, LHX8, MSH4, NANOS3, PGRMC1, REC8, SMC1B |
Oocyte maturation defects | TUBB8, ZP1 |
Embryo development arrest | PADI6, TLE6 |
Ovarian hyperstimulation syndrome | FSHR, AMH, AMHR2, CAPN10, DENND1A, GDF9 LHCGR, SULT2A1, THADA |
Recurrent pregnancy loss | F2, F5, MTHFR, PROC, PROS1 SERPINC1, SYCP3 |
Hormone receptors* | AR, ESR1, FSHR, LHCGR |
Male conditions |
|
Non-obstructive azoospermia/ Severe oligospermia | AR, AZF, FGFR1, FSHB, KAL1/ANOS1, KISS1R, KLHL10, LHB, NANOS1, NR5A1, SOHLH1, SYCE1, SYCP3, TAF4B, TEX11, TEX15, USP9Y, ZMYND15, HSF2 |
Obstructive azoospermia | ADGRG2, CFTR |
Oocyte activation failure | PLCZ1 |
Asthenozoospermia | CATSPER1, DNAH1, DNAH5, DNAI1 SEPT12, SLC26A8, SUN5, CATSPER2 GALNTL5 |
Sperm morphology alterations | AURKC, DPY19L2, SEPT12 SPATA16, SUN5, PICK1, ZPBP |
Hormone receptors* | AR, ESR1, FSHR, LHCGR |
*Hormone receptors are evaluated in both panels.
Genes associated with female and male infertility included in the NGS panel. Genes in bold font have proven associations with infertility (diagnostic genes). Candidate genes are shown in normal font.
References:
- Strande NT, Riggs ER, Buchanan AH, Ceyhan-Birsoy O, DiStefano M, Dwight SS, Goldstein J, Ghosh R, Seifert BA, Sneddon TP, Wright MW, Milko LV, Cherry JM, Giovanni MA, Murray MF, O’Daniel JM, Ramos EM, Santani AB, Scott AF, Plon SE, Rehm HL, Martin CL, Berg JS. Evaluating the Clinical Validity of Gene-Disease Associations: An Evidence-Based Framework Developed by the Clinical Genome Resource. Am J Hum Genet. 2017; 100: 895-906. doi: 10.1016/j.ajhg.2017.04.015.
- Illumina, Inc. Bcl2fastq Conversion Software. San Diego: Illumina; 2017. Version 2.17.1.14.
- Babraham Bioinformatics. FastQC: a quality control tool for high throughput sequence data.Cambridge: Babraham Bioinformatics; 2017. Version 0.11.7.
- Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler Transform. 2009; 25: 1754–1760. doi: 10.1093/bioinformatics/btp324.
- Van der Auwera GA, Carneiro MO, Hartl C, Poplin R, Del Angel G, Levy-Moonshine A, Jordan T, Shakir K, Roazen D, Thibault J, Banks E, Garimella KV, Altshuler D, Gabriel S, DePristo MA. From FastQ data to high confidence variant calls: the Genome Analysis Toolkit best practices pipeline. Curr Protoc Bioinformatics. 2013; 43: 11.10.1–11.1033. doi: 10.1002/0471250953.bi1110s43.
- Cingolani P, Platts A, Wang le L, Coon M, Nguyen T, Wang L, Land SJ, Lu X, Ruden DM. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly (Austin) 2012; 6: 80-92. doi: 10.4161/fly.19695.
- Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, Grody WW, Hegde M, Lyon E, Spector E, Voelkerding K, Rehm HL, ACMG Laboratory Quality Assurance Committee Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med. 2015; 17: 405-423. doi: 10.1038/gim.2015.30.
- den Dunnen JT, Dalgleish R, Maglott DR, Hart RK, Greenblatt MS, McGowan-Jordan J, Roux AF, Smith T, Antonarakis SE, Taschner PE. HGVS Recommendations for the Description of Sequence Variants: 2016 Update. Hum Mutat. 2016; 37: 564-569. doi: 10.1002/humu.22981.
- Krausz C, Hoefsloot L, Simoni M, Tüttelmann F. European Academy of Andrology; European Molecular Genetics Quality Network. EAA/EMQN best practice guidelines for molecular diagnosis of Y-chromosomal microdeletions: state-of-the-art 2013. 2014; 2: 5-19. doi: 10.1111/j.2047-2927.2013.00173.x.
- Lorenzi D, Fernandez C, Bilinski M, Fabbro M, Galain M, Menazzi S, Miguens M, Perassi PN, Fulco MF, Kipelman S, Fiszbajn G, Nodar F, Papier S. First custom next-generation sequencing infertility panel in Latin America: design and first results. JBRA Assist Reprod. 2020; 24(2): 104-114. doi: 10.5935/1518-0557.20190065
A joint study on the regional genetic and epidemiological profile and the most common microbial species in symptomatic or asymptomatic infertile persons was developed using the data collected during the project from both sides of the cross-border region.
Infertility is a multifactorial health issue affecting couples worldwide, and its etiology varies across populations. This study aims to explore the regional microbiologic and genetic profiles of infertility in Romania and Hungary, shedding light on the unique factors contributing to reproductive challenges in these two Central European countries in the cross-border area.
According to WHO, addressing infertility is an important component of sexual and reproductive health and rights, and is central to achieving SDG 3 (Ensure healthy lives and promote well-being for all at all ages) and SDG 5 (Achieve gender equality and empower all women and girls) (SDG – Sustainable Development Goal). Addressing infertility is also central to achieving the human rights to the enjoyment of the highest attainable standard of physical and mental health and to decide the number, timing and spacing of one’s children. Understanding the magnitude of infertility is critical for developing appropriate interventions, for monitoring access to quality fertility care, and for mitigating risk factors for and consequences of infertility. Yet there is considerable variation in estimates of infertility. Differences in how infertility is defined and measured partly contribute to this variation.

In the WHO report, 75 health for all, Human Reproduction Programme, Infertility prevalence estimates between 1990-2021, regional infertility prevalence estimates are defined as lifetime infertility prevalence and period of infertility prevalence. These statistics indicate that the European region has the highest prevalence estimates ranges, between 5.0-34.0 %.


- Study Design:
- Cross-sectional study design
- Inclusion criteria: Couples seeking fertility evaluation and treatment in selected regions of Romania and Hungary
- Exclusion criteria: Couples with known medical conditions affecting fertility unrelated to microbiologic or genetic factors.
- Data Collection:
- Microbiologic Profile:
- Collection of genital samples from both partners for microbiological analysis, including bacterial and viral assessments.
- Investigation of sexually transmitted infections (STIs) and other relevant microbial factors.
- Genetic Profile:
- Blood samples obtained from both partners for genetic testing.
- Analysis of common genetic mutations associated with infertility.
- Assessment of chromosomal abnormalities.
- Demographic and Clinical Data:
- Collection of demographic information, medical history, lifestyle factors, and previous fertility treatments.
- Laboratory Analysis:
- Microbiologic Analysis:
- Culture and sensitivity testing for bacterial and viral isolates.
- Polymerase chain reaction (PCR) assays for specific pathogens.
- Quantitative analysis of microbial load.
- Genetic Analysis:
- DNA extraction and purification.
- Genotyping for known genetic markers associated with infertility.
- Karyotyping for chromosomal abnormalities.
- Statistical Analysis:
- Descriptive statistics for demographic and clinical variables.
- Comparison of microbiologic and genetic profiles between regions using appropriate statistical tests.
- Correlation analysis between microbiologic and genetic factors with infertility outcomes.
The study’s results provided insights into the prevalence of microbial infections and genetic factors contributing to infertility in different regions of Romania and Hungary. Comparative analyses identified potential regional variations and patterns.
Understanding the regional microbiologic and genetic profiles of infertility in Romania and Hungary is crucial for developing targeted interventions and personalized treatment strategies. This study contributes valuable data to the global understanding of infertility, helping healthcare professionals tailor interventions to the specific needs of the population in these Central European countries.
Microorganisms capable of interfering with the reproductive function of women
The top microorganisms involved in UGT infections, and considered as causes of female cervicitis, PID, infertility, and preterm delivery are:
- trachomatis
- gonorrhoeae,
- bacterial vaginosis (Gardnerella vaginalis infections)
- Ureaplasma urealyticum and Mycoplasma hominis
An important role in female infertility: Treponema pallidum, Candida spp., Cytomegalovirus, Trichomonas vaginalis, Toxoplasma gondii, etc.
GNB, GPC: some other causes of the acute inflammatory diseases of the UGT, in infertile, pregnant women or neonate infections.
Infections occurring around the time of birth
Effects on the foetus and neonates
- Viral infections:
- rubella, CMV – less damaging to the foetus when maternal infection takes place late in pregnancy;
- varicella-zoster virus at this time can lead to limb deformities and other severe lesions in the newborn.
- Bacterial infections:
- group B streptococci, coli, Klebsiella, Proteus,Bacteroides, staphylococci, Mycoplasma hominis)
These infections are originating from the vagina and perineum are more important, occurring especially when fetal membranes have been ruptured for more than 1-2 days, and resulting in chorioamnionitis, maternal fever, premature deliver. They can be acquired after delivery, giving later onset disease. Infants of low birth weight (less than 1500g) tend to be more severely affected. Neonatal septicemia often progresses to meningitis – frequently fatal unless treated.
Clinical diagnosis is difficult because the infant shows generalized signs: respiratory distress, poor feeding, diarrhea and vomiting, but early diagnosis is essential and requires emergency treatment.
Miscellaneous neonatal infections
Infection may reach the newborn infant during the first week or two after birth, rather than during delivery.
- Group B beta-haemolytic streptococci and GNB can still cause serious infection at this time, often with meningitis;
- Herpes simplex may come from cold sores of attending adults;
- During the first week or two of life the nose of the neonate becomes colonized with aureus which can enter the nipple during feeding to cause a breast abscess.
These infections are preventable when hospital staff pay vigorous attention to hand washing and aseptic techniques.
Effects on the mother
Puerperal sepsis was a major cause of maternal death in Europe in the 19th Century. In 1843 Oliver Wendell Holmes made the unpopular suggestion that it was carried on the hands of doctors, and four years later Ignaz Semmelweiss in Vienna showed how it could be prevented if doctors washed their hands before attending a woman in labor and practiced aseptic techniques.
Major culprits for puerperal sepsis were:
- Group A beta-hemolytic streptococci,
- Other possible organisms include anaerobes such as Clostridium perfringens or Bacteroides, and E. coli.
The streptococci came from the nose, throat or skin of hospital attendants whereas the others were derived from the mother’s own fecal flora. Puerperal sepsis, which carried up to 10% mortality until the 1930s, is now, like septic abortion, less common in developed countries. Predisposing factors include: premature rupture of the membranes, instrumentation and retained fragments of membrane or placenta. Where there is postnatal pyrexia or massive discharge, high vaginal swabs and blood cultures should be taken.
Infections in newborns
Infections remain one of the most significant problems in modern medicine. Once the fetus is infected it is susceptible, its immune defenses are poor, IgM and lgA antibodies are not produced in significant amounts until the second half of pregnancy and cell-mediated immune responses are poorly developed or absent, with inadequate production of the necessary cytokines. The newborn’s microbiome contributes to the development of its immune system. Antibiotics administered during pregnancy alter the microbiome and may influence disease risks in newborns.
Vaginal colonization with bacteria that can cause infections in newborns
The predominant flora in the vagina is represented by Lactobacillus and Streptococcus spp. However, the presence of other bacteria such as E. coli, Klebsiella spp. can be very important, although not necessarily synonymous with infection. E. coli in the vagina can cause symptomatic or asymptomatic infections and is associated with neonatal sepsis. These strains possess several virulence factors that allow vaginal and/or endocervical colonization. E. coli – important cause of neonatal respiratory tract infections and is associated with high mortality. High prevalence of Klebsiella ESBL colonization that can be transmitted to newborns at birth have also been reported.
Maternal-to-newborn transmission of E. coli can cause early infections in newborns and can occur after infection of the amniotic fluid, after rupture of membranes, or during the passage of the newborn through the vaginal canal during birth. E. coli and group B streptococcus are cited as the two most frequent bacteria isolated from neonates with sepsis or meningitis. Neonates born at preterm gestational ages are more likely to develop neonatal sepsis and meningitis. The rates of vaginal colonization with Staphylococcus spp. range from 5 to 26% and there is increasing incidence of infections in pregnant women as well as neonates caused by these organisms. S. aureus is more prevalent in vaginal tract of pregnant women when compared to the other species.
The study of microbial infections/colonization during pregnancy
This is an observational, retrospective study which included all strains isolated from pregnant women hospitalized in our hospital, due to any infectious disease between 01.09.2021-01.09.2022 during one-year period. “Pius Brinzeu” Clinical County Emergency Hospital Timișoara (SCJUPBT), is a tertiary medical care unit with 1,174 beds, of which 82 beds are in Obstetrics-Gynecology Departments. The laboratory analyses were performed as follows:
- Microbial identification – MALDI-TOF
- Antimicrobial sensitivity tests – VITEK system with MIC determination (2021 CLSI standards)
- Genes identification with Unyvero system in one case of new-born BSI
A total number of 260 pregnant women under medical follow-up were monitored for: maternal diseases (hypertension, kidney diseases, thyroiditis, anemia, etc.) and maternal diseases associated with pregnancy (preeclampsia, pathological pregnancy, placenta previa).
Table 1. Patients from OG
Total no. of patients from OG | Pregnant women | Gynecological pathology |
506 | 260 | 246 |
% | 51.38 | 48.62 |
Table 2. Sample types
Samples | Cervical samples | Urine cultures | Amniotic fluids | Peritoneal fluids | Wound secretions | Sputum |
275 | 250 | 15 | 3 | 2 | 4 | 1 |

Fig. 1. Microscopical examination from our own collection, Zeiss Primo Star microscope with digital video camera.
Table 3. Microorganisms and their AMR patterns from clinical samples (other than cervical)
Sample type | Sample no. | Microorganism | Resistance phenotypes | Diagnosis/treatment |
Urine | 15 | E. coli Streptococcus group B Enterococcus spp. | ESBL E. coli | UTI |
Amniotic fluid | 3 | S. epidermidis S. lugdunensis E. faecalis | Without acquired resistance phenotypes | – |
Peritoneal fluid | 2 | P. aeruginosa and A. baumannii S. aureus | A. baumannii (CR) S. aureus – BL producing phenotype | Post cesarean complications solved by total hysterectomy |
Sputum | 1 | C. albicans | – | SARS-CoV-2 infection |
Wound secretions | 4 | S. aureus Klebsiella spp. | S. aureus (BL/MLSB) Klebsiella spp. (CASE) | Post cesarean complications |

Fig. 2. Microorganisms from cervical samples – 250
Table 4. E. coli identification in various samples
E. coli | Abortion | Premature birth | Ectopic pregnancies | Pregnancy in evolution/full-term |
96 | 33 | 8 | 7 | 48 |
% | 34.37% | 8.33% | 7.29% | 50% |

Fig. 3. E. coli identification in different samples
Table 5. Group B Streptococcus identification in various samples
Group B Streptococcus | Abortion | Premature birth | Ectopic pregnancies | Pregnancy in evolution/full term |
80 | 12 | 4 | 4 | 60 |
% | 15% | 5% | 5% | 75% |

Fig. 4. Group B Streptococcus identification in different samples
Table 6. Group B Streptococcus antibiotic resistance pattern
Group B Streptococcus | R-Te | MLSB | R-FQ | R-P | MDR |
80 | 49 | 20 | 9 | 6 | 22 |
61.25% | 25% | 11.25% | 7.5% | 27.16% |

Fig. 5. Group B Streptococcus antibiotic resistance in different samples
A percentage of 27% (22 samples) of the strains were MDR phenotype, associating resistance to BL / FQ / MLSB. These MDR strains were identified from pregnant women in 7-19 weeks of pregnancy, in the stage of imminent abortion or metrorrhagia.
Table 7. S. aureus identification in various samples
S. aureus | Abortion | Premature birth | Ectopic pregnancies | Pregnancy in evolution/full term |
49 | 6 | 5 | 1 | 38 |
% | 12.24% | 10.20% | 2.04% | 75.51% |

Fig. 6. S. aureus identification in different samples
Table 8. S. aureus antibiotic resistance pattern
S. aureus | Beta-lactamase | MRSA | MLSB | R-M | R-FQ | R-SXT | MDR |
92 | 22 | 15 | 13 | 13 | 5 | 5 | 19 |
% | 44.89% | 30.61% | 26.53% | 26.53% | 10.2% | 10.2% | 38.77% |

Fig. 7. S. aureus antibiotic resistance in different samples
A percentage of 30.61% of the strains were MRSA and 38.77% were MDR phenotype, associating resistance to BL / FQ / MLSB. Of the pregnant women with MRSA, approximately 1/4 were hospitalized for abortion in progress or imminent abortion and the rest of 3/4, for monitoring / delivery.
Table 9. K. pneumoniae identification in various samples
K. pneumoniae | Abortion | Premature birth | Ectopic pregnancies | Pregnancy in evolution/full term |
32 | 6 | 4 | 1 | 21 |
% | 18.75% | 12.5% | 3.12% | 65.62% |

Fig. 8. K. pneumoniae identification in different samples
Table 10. K. pneumoniae antibiotic resistance pattern
K. pneumoniae | ESBL | FQ-R | SXT-R | AG-R | MDR |
32 | 2 | 2 | 5 | 1 | 1 |
% | 6.25% | 6.25% | 15.62% | 3.12% | 3.12% |

Fig. 9. K. pneumoniae antibiotic resistance in different samples

Fig. 10. Comparative analysis of clinical condition and identified pathogens

Fig. 11. Blood culture result in a newborn with XDR A. baumannii
It is necessary to develop a universal method for screening vaginal-rectal GBS colonization in pregnant women worldwide. Streptococcus agalactiae could cause severe infections in neonates. Group B Streptococcus (GBS), are often associated with GBS transmission from their mothers during labor or birth. The proposed MALDI detection method with analysis of peaks of TOF (MDAPT) detects GBS directly from cultured broth with high sensitivity. Therefore, it can be an alternative method for GBS screening in pregnant women, thereby contributing to the prevention of severe GBS infectious diseases in neonates. As previously reported, 10%-30% of pregnant women carry Streptococcus agalactiae, Group B Streptococcus (GBS), in their vagina or rectum, and approximately 50% of them vertically transmit GBS to their neonates during labor or birth. Moreover, 1%-2% of the GBS-transmitted neonates develop severe GBS infectious diseases, which have a mortality rate of 19.2% in a preterm infant and 2.1% in a full-term infant.
Administration of antibiotics during pregnancy leads to changes in the vaginal microbial ecology before birth, with potential for morbidity, and long-term effects on the early microbial colonization of the newborn. Women who received oral antibiotics during any trimester of pregnancy had an increased rate of colonization with staphylococcal species in vaginal samples, compared with samples obtained from women without antibiotic treatment during pregnancy. Oral antibiotic administration for urinary tract infections in the third trimester was also associated with increased colonization by Staphylococcus species. Women treated in the third trimester for respiratory tract infection – were more often colonized with Escherichia coli than women without antibiotic treatment. Significant changes in vaginal colonization with Streptococcus agalactiae (group B streptococcus) following antibiotic treatment during pregnancy were not observed.
Regarding GNB, we can conclude that low incidence of resistant strains with clinical significance are: UTI with 1 ESBL-E. coli; SSI with 2 CASE-Klebsiella sp.; Peritonitis with 1 CR-Acinetobacter baumannii. The high incidence of E. coli strains in cervical secretions was noted, but taking into account the clinical significance of the presence of this strain in the cervix (considered colonization) as well as the low antimicrobial resistance (they are community strains), it can be appreciated that treatment in these cases – is necessary only if the clinical condition of the patients requires such an approach but their resistance pattern must be known in the case of detecting early infections in newborns.
What is noteworthy is the fact that GPC registered high frequencies, and the isolated strains show resistance to antimicrobials that describe resistance phenotypes that pose therapeutic problems. Group B streptococcus registers high frequencies in pregnant women and those hospitalized for full-term birth (35.08%) but also in those hospitalized for premature birth (19.04%). Colonization with S. aureus should also be mentioned, as long as most of the strains were of the MRSA type or associated multiple resistance mechanisms, so adequate supervision and treatment due to the potential for illness in newborns is required.
Empiric and definitive antimicrobial treatment in early and late onset infections in newborns should be applied. Infections with MDR pathogens, especially those caused by ESBL/CRE Enterobacterales or MRSA are associated with increased risk of morbidity and mortality. Treatment options for these infections are limited and efficacy and safety of novel antibiotics are currently extrapolated from adult data, requiring dose optimization in clinical trials for Ceftazidime/avibactam, Meropenem/vaborbactam, Imipenem/cilastatin/relebactam, cefiderocol.

Fig. 12. Microbiological tests performed for identification of bacterial-induced infertility

Fig. 13. Granulocytes presence in the specimen indicating a bacterial infection

Fig. 14. Identification of lactobacilli in different specimens

Fig. 15. Bacterial vaginosis (BV) identified in samples received during a period of 2 years

Fig. 16. Samples distributed by several medical departments

Fig. 17. Diagnostic of female infertiliry
The most frequent isolated microorganisms in 2021 and 2022 were: E. coli, C. albicans and S. agalactiae.

Fig. 18. Prevalence of isolated pathogens

Fig. 19. Most frequent pathogens isolated from different samples

Fig. 20. Antibiotic resistance rates by pathogen and drug
Ceftazidime and cefriaxone susceptibility testing were performed only for the ESBL producing or AmpC positive E. coli isolates. ESBL producing or AmpC positive E. coli isolates were resistant to cefixime also. Half part of the ampicillin and amoxicillin-clavulanic acid resistant E. coli isolates are susceptible and half part of them were resistant to cefixime.

Fig. 21. Antibiotic resistance rates by pathogen and drug

Fig. 22. Differences in antibiotic resistance rates between 2022 and 2021
In the case of patients with abnormal vaginal microscopical result, aerobic vaginitis and bacterial vaginosis were more likely to occur.
Table 11. Correlation between the presence of granulocytes and lactobacilli or pathogens
| Granulocytes | Lactobacilli | Path | Correlation Granulocytes/Lactobacilli | Correlation Granulocytes/Path |
| 141 | 1019 | 309 | -1 | 1 |
| 1248 | 365 | 1080 |
There is a positive correlation between the presence of granulocytes and a positive vaginal culture results. And there is a negative correlation between the presence of lactobacilli and the symtoms and the positive vaginal culture results.
Table 12. Correlation between the diagnosis of bacterial vaginosis (BV) and the presence of lactobacilli or pathogens
BV | Lactobacilli | Path | Corellation BV vs. Lacto | Correlation BV vs. Path | |
99 | 1019 | 308 | -1 | 1 | |
1282 | 357 | 1073 |
Infertility, defined as the inability to conceive after a year of regular unprotected intercourse, affects millions of couples worldwide. While numerous factors contribute to reproductive challenges, recent advancements in medical science have underscored the importance of genetic testing in understanding and addressing infertility. This comprehensive exploration delves into the significance, types, methodologies, and ethical considerations associated with genetic testing in the context of infertility.
- Genetic Basis of Infertility
Hereditary Factors. Infertility often has a genetic basis, with hereditary factors playing a crucial role. Genetic mutations, chromosomal abnormalities, and variations in specific genes can significantly impact fertility in both men and women.
Genetic Disorders and Infertility. Certain genetic disorders, such as Turner syndrome, Klinefelter syndrome, and cystic fibrosis, are known to be associated with infertility. Genetic testing allows for the identification of these conditions, enabling targeted interventions and family planning.
- Types of Genetic Testing in Infertility
Preconception Genetic Testing. Preconception genetic testing involves assessing the genetic compatibility of prospective parents. This form of testing can identify carriers of specific genetic conditions, allowing couples to make informed decisions about family planning.
Carrier Screening.Carrier screening is particularly relevant for couples with a family history of genetic disorders. By identifying carriers of recessive genetic conditions, couples can understand their risk of passing on such conditions to their offspring.
Preimplantation Genetic Testing (PGT). PGT is a groundbreaking technique used in assisted reproductive technologies (ART). It involves the genetic analysis of embryos before implantation, allowing the selection of embryos free from chromosomal abnormalities or specific genetic mutations.
Genetic Testing in Male Infertility. Genetic testing is instrumental in diagnosing male infertility. Y chromosome microdeletions, karyotype analysis, and testing for specific gene mutations associated with sperm production are commonly employed to identify genetic factors contributing to male infertility.
Genetic Testing in Female Infertility. For women, genetic testing can help identify conditions such as polycystic ovary syndrome (PCOS) and premature ovarian insufficiency (POI). Additionally, chromosomal analysis can uncover abnormalities affecting egg quality.
III. Methodologies in Genetic Testing for Infertility
Karyotyping. Karyotyping involves the visualization and analysis of an individual’s chromosomes. This technique is crucial for identifying numerical and structural chromosomal abnormalities that may contribute to infertility.
Polymerase Chain Reaction (PCR). PCR is a widely used technique for amplifying specific DNA sequences. It is employed in genetic testing to identify mutations associated with infertility, such as those linked to sperm production or hormonal regulation.
Next-Generation Sequencing (NGS). NGS allows for the rapid and cost-effective sequencing of DNA. In the context of infertility, NGS is employed for comprehensive genetic analysis, including the screening of multiple genes simultaneously.
Comparative Genomic Hybridization (CGH). CGH is utilized in PGT to assess chromosomal abnormalities in embryos. By comparing the genetic material of embryos, CGH helps identify those with a higher likelihood of successful implantation.
- Ethical Considerations in Genetic Testing for Infertility
Informed Consent. Given the sensitive nature of genetic information, obtaining informed consent from individuals undergoing genetic testing is imperative. This ensures that individuals are aware of the potential implications of the results.
Privacy and Confidentiality. Protecting the privacy and confidentiality of genetic information is paramount. Healthcare providers and researchers must adhere to strict ethical guidelines to safeguard individuals’ genetic data.
Reproductive Autonomy. Genetic testing raises questions about reproductive autonomy, as individuals may be faced with decisions about family planning, embryo selection, and the potential use of assisted reproductive technologies based on genetic information.
Genetic testing has emerged as a powerful tool in unraveling the complexities of infertility. From identifying hereditary factors to enabling targeted interventions through assisted reproductive technologies, genetic testing offers hope to couples grappling with reproductive challenges. However, ethical considerations must accompany the advancements in this field to ensure the responsible and informed use of genetic information. As technology continues to advance, genetic testing will likely play an increasingly pivotal role in the holistic management of infertility, fostering a new era of personalized and precise reproductive medicine.
Infertility stands as a worldwide health concern impacting millions of individuals in their reproductive years across the globe. Existing data indicates that one in six people globally grapple with infertility at some point in their lives. It is characterized as a condition affecting the male or female reproductive system, marked by the inability to achieve pregnancy after 12 months or more of consistent unprotected sexual intercourse. Primary infertility denotes the incapacity to experience any pregnancy, while secondary infertility pertains to the inability to conceive after having previously achieved successful conception. The International Classification of Diseases by the World Health Organization (WHO) offers comprehensive insights into the various primary and secondary factors contributing to infertility in both women and men.
Infertility can stem from male factors, female factors, a combination of both, or may remain unexplained. Regardless of the cause, lifestyle choices such as smoking, excessive alcohol consumption, and obesity have been linked to an increased risk of infertility for both men and women.
- Infertility is defined as a malfunction in the male or female reproductive system, characterized by the inability to achieve pregnancy after 12 months or more of consistent unprotected sexual intercourse.
- This condition has a profound impact on millions of individuals, affecting not only their lives but also their families and communities. Approximately one in every six people of reproductive age worldwide is estimated to experience infertility at some point in their lifetime.
- In the male reproductive system, infertility is commonly attributed to issues with semen ejaculation, absence or low levels of sperm, or abnormalities in sperm shape (morphology) and movement (motility).
- In the female reproductive system, infertility may result from various abnormalities in the ovaries, uterus, fallopian tubes, and the endocrine system, among other factors.
- Infertility is categorized as primary when an individual has never achieved pregnancy and as secondary when at least one prior pregnancy has been attained.
- Fertility care involves the prevention, diagnosis, and treatment of infertility. However, equal and equitable access to fertility care remains a challenge in most countries, especially in low and middle-income nations. Fertility care is seldom prioritized in national universal health coverage benefit packages.
Why is it crucial to address infertility? Every individual is entitled to the highest achievable standard of physical and mental health, encompassing the right to make decisions about the number, timing, and spacing of their children. Infertility can undermine the realization of these fundamental human rights. Consequently, addressing infertility becomes a vital component of ensuring individuals and couples exercise their right to establish a family.
A diverse range of individuals, including heterosexual couples, same-sex partners, older individuals, those not in sexual relationships, and those with specific medical conditions such as some HIV sero-discordant couples and cancer survivors, may find themselves in need of infertility management and fertility care services. Disparities and inequities in access to these services disproportionately impact vulnerable populations, including the poor, unmarried, uneducated, unemployed, and other marginalized groups.
Tackling infertility also has the potential to alleviate gender inequality. While both men and women can encounter infertility, societal perceptions often attribute infertility issues to women in relationships, irrespective of their actual fertility status. The social ramifications of infertility significantly impact the lives of infertile couples, particularly women, who may face violence, divorce, social stigma, emotional stress, depression, anxiety, and diminished self-esteem. In certain contexts, the fear of infertility can dissuade individuals from using contraception, especially if they feel compelled by societal expectations to demonstrate fertility early in life due to the high social value placed on childbearing. In such scenarios, it becomes imperative to implement educational and awareness initiatives to enhance understanding of the prevalence and determinants of fertility and infertility.
Addressing Challenges
Challenges persist in the availability, accessibility, and quality of interventions to tackle infertility in the majority of countries. The diagnosis and treatment of infertility often lack prioritization in national population and development policies, as well as reproductive health strategies, and are seldom covered by public health financing. Additionally, a shortage of trained personnel, inadequate equipment and infrastructure, and the current high costs of treatment medicines pose significant barriers, even for countries actively addressing the needs of individuals with infertility.
Despite assisted reproduction technologies (ART) being accessible for over three decades, with more than 5 million children worldwide born from ART interventions such as in vitro fertilization (IVF), these technologies remain largely inaccessible and unaffordable in numerous parts of the world, especially in low and middle-income countries (LMIC).
In addition, enabling laws and policies that regulate third party reproduction and ART are essential to ensure universal access without discrimination and to protect and promote the human rights of all parties involved. Once fertility policies are in place, it is essential to ensure that their implementation is monitored, and the quality of services is continually improved.
WHO response
WHO acknowledges that delivering high-quality family planning services, which encompass fertility care, is a fundamental component of reproductive health. In recognition of the significance and impact of infertility on people’s overall quality of life and well-being, WHO is dedicated to addressing infertility and fertility care through the following:
- Collaborating with partners to conduct global epidemiological and etiological research on infertility.
- Engaging in and facilitating policy dialogues with countries worldwide to situate infertility within a supportive legal and policy framework.
- Supporting the generation of data on the burden of infertility to guide resource allocation and service provision.
- Developing guidelines covering the prevention, diagnosis, and treatment of male and female infertility, integrating them into global norms and standards for quality care in fertility services.
- Regularly revising and updating normative products, including the WHO laboratory manual for the examination and processing of human semen.
- Collaborating with relevant stakeholders, such as academic centers, ministries of health, other UN organizations, non-state actors (NSAs), and additional partners, to enhance political commitment, availability, and health system capacity for delivering fertility care on a global scale.
- Offering country-level technical support to member states for the development or enhancement of national fertility policies and services.